KANK1

KN motif and ankyrin repeat domains 1, the group of KN motif and ankyrin repeat domain containing

Basic information

Region (hg38): 9:470290-746105

Previous symbols: [ "ANKRD15" ]

Links

ENSG00000107104 ∙ NCBI:23189 ∙ OMIM:607704 ∙ HGNC:19309 ∙ Uniprot:Q14678 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• cerebral palsy, spastic quadriplegic, 2 (Limited), mode of inheritance: Autosomal dominant inheritance with maternal imprinting HP:0012275
• spastic quadriplegic cerebral palsy (Supportive), mode of inheritance: AR
• cerebral palsy, spastic quadriplegic, 2 (Limited), mode of inheritance: AD
• cerebral palsy, spastic quadriplegic, 2 (Limited), mode of inheritance: Unknown

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Cerebral palsy, spastic quadriplegic, 2	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	16301218

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KANK1 gene.

• not provided (575 variants)
• Inborn genetic diseases (108 variants)
• Cerebral palsy, spastic quadriplegic, 2 (99 variants)
• not specified (10 variants)
• KANK1-related condition (4 variants)
• Abnormal brain morphology (1 variants)
• KANK1- Related Disorder (1 variants)
• Rare genetic intellectual disability (1 variants)
• Amyotrophic lateral sclerosis (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KANK1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1	107	13	121
missense		1	309	27	9	346
nonsense			5			5
start loss			2			2
frameshift			7			7
inframe indel			11	3	1	15
splice donor/acceptor (+/-2bp)			3			3
splice region			5	13	4	22
non coding			6	39	72	117
Total	0	1	344	176	95

Variants in KANK1

This is a list of pathogenic ClinVar variants found in the KANK1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
9-676569-C-T			Benign (Dec 29, 2019)
9-676571-T-C			Benign (Oct 25, 2019)
9-676646-A-G			Likely benign (Jan 04, 2021)
9-676692-T-C			Benign (Nov 12, 2018)
9-676704-T-C			Benign (Jan 12, 2020)
9-676741-A-G			Benign (Feb 01, 2020)
9-676745-A-G			Benign (Feb 03, 2020)
9-676820-A-G			Benign (Nov 20, 2019)
9-676837-T-TG			Benign (Nov 20, 2019)
9-676954-T-C			Benign (Dec 25, 2019)
9-676973-A-T			Uncertain significance (Feb 28, 2022)
9-676973-AT-TG		KANK1-related disorder	Uncertain significance (Oct 20, 2022)
9-676976-GC-G		Abnormality of neuronal migration	Benign (Oct 31, 2014)
9-676980-A-G			Uncertain significance (Sep 14, 2022)
9-676981-C-T		Cerebral palsy, spastic quadriplegic, 2	Likely benign (Jul 26, 2023)
9-676986-C-G			Uncertain significance (Mar 24, 2023)
9-676988-A-G			Likely benign (Jan 17, 2024)
9-676996-C-T			Likely benign (Oct 05, 2022)
9-677007-C-T			Uncertain significance (Dec 27, 2022)
9-677018-G-C			Likely benign (Nov 16, 2022)
9-677089-G-A			Benign (Dec 25, 2019)
9-677141-A-G			Benign (Feb 03, 2020)
9-677211-C-G			Likely benign (Jan 16, 2020)
9-707443-G-A			Likely benign (Apr 01, 2023)
9-707445-TGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACATTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACATTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACAGTCCTGGAGACAGGTCTGGCTGCTGCAGCTTCTCTCCTGTTAATGGAGTTTCAGACATTCCTGGAGACAGGTCTGGCTGCTGC-T		Schizophrenia	Uncertain significance (Nov 11, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KANK1	protein_coding	protein_coding	ENST00000382303	11	275815

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
7.98e-18	0.567	125621	0	127	125748	0.000505

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-4.81	1165	786	1.48	0.0000446	8877
Missense in Polyphen		343	247.94	1.3834		2814
Synonymous	-5.27	433	314	1.38	0.0000193	2711
Loss of Function	1.84	34	47.7	0.712	0.00000245	581

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00115	0.00115
Ashkenazi Jewish	0.00	0.00
East Asian	0.00103	0.00103
Finnish	0.000647	0.000647
European (Non-Finnish)	0.000445	0.000431
Middle Eastern	0.00103	0.00103
South Asian	0.000393	0.000392
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Involved in the control of cytoskeleton formation by regulating actin polymerization. Inhibits actin fiber formation and cell migration. Inhibits RhoA activity; the function involves phosphorylation through PI3K/Akt signaling and may depend on the competetive interaction with 14-3-3 adapter proteins to sequester them from active complexes. Inhibits the formation of lamellipodia but not of filopodia; the function may depend on the competetive interaction with BAIAP2 to block its association with activated RAC1. Inhibits fibronectin-mediated cell spreading; the function is partially mediated by BAIAP2. Inhibits neurite outgrowth. Involved in the establishment and persistence of cell polarity during directed cell movement in wound healing. In the nucleus, is involved in beta-catenin-dependent activation of transcription. Potential tumor suppressor for renal cell carcinoma. {ECO:0000269|PubMed:16968744, ECO:0000269|PubMed:18458160, ECO:0000269|PubMed:19171758, ECO:0000269|PubMed:22084092}.

Recessive Scores

• pRec: 0.0989

Intolerance Scores

• loftool: 0.810
• rvis_EVS: -0.92
• rvis_percentile_EVS: 9.78

Haploinsufficiency Scores

• pHI: 0.517
• ghis: 0.519

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.205

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	High	High	High
Primary Immunodeficiency	High	High	High
Cancer	High	High	High

Mouse Genome Informatics

• Gene name: Kank1

Gene ontology

• Biological process: cell population proliferation;negative regulation of neuron projection development;actin cytoskeleton organization;positive regulation of Wnt signaling pathway;negative regulation of cell migration;negative regulation of actin filament polymerization;regulation of Rho protein signal transduction;negative regulation of Rho protein signal transduction;negative regulation of insulin receptor signaling pathway;positive regulation of canonical Wnt signaling pathway;positive regulation of wound healing;glomerular visceral epithelial cell migration;negative regulation of substrate adhesion-dependent cell spreading;negative regulation of ruffle assembly;regulation of establishment of cell polarity;negative regulation of lamellipodium morphogenesis
• Cellular component: nucleus;cytoplasm;plasma membrane;ruffle membrane
• Molecular function: protein binding;beta-catenin binding