KAT2B

lysine acetyltransferase 2B, the group of ATAC complex|GCN5 related N-acetyltransferases|SAGA complex|MicroRNA protein coding host genes|Bromodomain containing|Lysine acetyltransferases

Basic information

Region (hg38): 3:20040445-20154404

Previous symbols: [ "PCAF" ]

Links

ENSG00000114166 ∙ NCBI:8850 ∙ OMIM:602303 ∙ HGNC:8638 ∙ Uniprot:Q92831 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KAT2B gene.

• not provided (45 variants)
• Inborn genetic diseases (26 variants)
• KAT2B-related condition (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KAT2B gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				2	2	4
missense			27		2	29
nonsense						0
start loss						0
frameshift			1			1
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region					2	2
non coding					35	35
Total	0	0	28	2	39

Variants in KAT2B

This is a list of pathogenic ClinVar variants found in the KAT2B region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
3-20040491-G-C		not specified	Uncertain significance (Jan 23, 2024)
3-20040509-GCTGCGGGGCAGGAGCCGGGGCAGGGGCCGGGCCCGGGGCGCTGCCCCCGCAGCCTGCGGCGCTTCCGCCCGCGCCCCCGCAGGGCTCCCCCTGCGCCGCTGCCGCCGGGGGCTCGGGCGC-G		KAT2B-related disorder	Likely benign (May 19, 2022)
3-20040536-C-T		not specified	Uncertain significance (Jun 07, 2023)
3-20040538-G-C		not specified	Uncertain significance (Feb 21, 2024)
3-20040542-C-T		not specified	Uncertain significance (Jul 15, 2021)
3-20040557-C-G		Inborn genetic diseases • KAT2B-related disorder	Conflicting classifications of pathogenicity (Apr 25, 2022)
3-20040581-C-T		KAT2B-related disorder • not specified	Conflicting classifications of pathogenicity (Jun 14, 2023)
3-20040590-A-T		not specified	Uncertain significance (Apr 18, 2023)
3-20040616-G-A		not specified	Uncertain significance (Nov 08, 2022)
3-20040616-G-C		KAT2B-related disorder	Uncertain significance (Jan 23, 2024)
3-20040662-G-A		KAT2B-related disorder	Likely benign (Apr 20, 2022)
3-20040688-G-A		not specified	Uncertain significance (Apr 12, 2022)
3-20040695-C-T		not specified	Uncertain significance (Aug 15, 2023)
3-20040862-T-G			Benign (May 12, 2021)
3-20072128-G-A			Benign (May 13, 2021)
3-20072338-G-A			Benign (Sep 01, 2019)
3-20072356-T-C		KAT2B-related disorder	Likely benign (Mar 25, 2021)
3-20072391-C-G		not specified	Uncertain significance (Aug 02, 2023)
3-20072392-C-A		KAT2B-related disorder	Likely benign (Jul 01, 2019)
3-20072399-G-C		not specified	Uncertain significance (Aug 04, 2023)
3-20072497-C-A			Benign (May 12, 2021)
3-20072552-T-C			Benign (May 12, 2021)
3-20072556-G-A			Benign (May 12, 2021)
3-20095119-C-T			Benign (May 12, 2021)
3-20095153-A-T			Benign (May 12, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KAT2B	protein_coding	protein_coding	ENST00000263754	18	114382

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.990	0.0103	125731	0	17	125748	0.0000676

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.24	298	429	0.695	0.0000223	5409
Missense in Polyphen		90	165.22	0.54474		2047
Synonymous	-0.827	170	157	1.08	0.00000840	1603
Loss of Function	5.43	8	49.0	0.163	0.00000295	550

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000261	0.000242
Ashkenazi Jewish	0.00	0.00
East Asian	0.000109	0.0000544
Finnish	0.0000930	0.0000924
European (Non-Finnish)	0.0000533	0.0000527
Middle Eastern	0.000109	0.0000544
South Asian	0.0000654	0.0000653
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Functions as a histone acetyltransferase (HAT) to promote transcriptional activation. Has significant histone acetyltransferase activity with core histones (H3 and H4), and also with nucleosome core particles. Also acetylates non-histone proteins, such as ACLY, PLK4 and TBX5. Inhibits cell-cycle progression and counteracts the mitogenic activity of the adenoviral oncoprotein E1A. Acts as a circadian transcriptional coactivator which enhances the activity of the circadian transcriptional activators: NPAS2-ARNTL/BMAL1 and CLOCK- ARNTL/BMAL1 heterodimers. Involved in heart and limb development by mediating acetylation of TBX5, acetylation regulating nucleocytoplasmic shuttling of TBX5 (PubMed:29174768). Acts as a negative regulator of centrosome amplification by mediating acetylation of PLK4 (PubMed:27796307). {ECO:0000269|PubMed:10675335, ECO:0000269|PubMed:14645221, ECO:0000269|PubMed:23932781, ECO:0000269|PubMed:27796307, ECO:0000269|PubMed:29174768, ECO:0000269|PubMed:8684459, ECO:0000269|PubMed:9707565}.
• Disease: DISEASE: Note=Defects in KAT2B has been found in a patient with isolated coloboma, a defect of the eye characterized by the absence of ocular structures due to abnormal morphogenesis of the optic cup and stalk, and the fusion of the fetal fissure (optic fissure). Isolated colobomas may be associated with an abnormally small eye (microphthalmia) or small cornea. {ECO:0000269|PubMed:28493397}.
• Pathway: HTLV-I infection - Homo sapiens (human);Thyroid hormone signaling pathway - Homo sapiens (human);Viral carcinogenesis - Homo sapiens (human);Notch signaling pathway - Homo sapiens (human);Androgen receptor signaling pathway;Notch Signaling Pathway;Nuclear Receptors Meta-Pathway;Ethanol effects on histone modifications;PTF1A related regulatory pathway;Notch Signaling Pathway;B-WICH complex positively regulates rRNA expression;Positive epigenetic regulation of rRNA expression;Notch;Disease;RUNX3 regulates NOTCH signaling;Signal Transduction;Epigenetic regulation of gene expression;Gene expression (Transcription);Transcriptional regulation by RUNX3;the information processing pathway at the ifn beta enhancer;nuclear receptors coordinate the activities of chromatin remodeling complexes and coactivators to facilitate initiation of transcription in carcinoma cells;Generic Transcription Pathway;Post-translational protein modification;Metabolism of proteins;RNA Polymerase I Promoter Clearance;RNA Polymerase II Transcription;RUNX1 regulates genes involved in megakaryocyte differentiation and platelet function;Chromatin modifying enzymes;Notch-HLH transcription pathway;RNA Polymerase I Transcription;NICD traffics to nucleus;YAP1- and WWTR1 (TAZ)-stimulated gene expression;RNA Polymerase I Transcription Initiation;Pre-NOTCH Transcription and Translation;Pre-NOTCH Expression and Processing;Signaling by NOTCH1;NOTCH3 Intracellular Domain Regulates Transcription;Signaling by NOTCH3;Signaling by NOTCH;AndrogenReceptor;Metalloprotease DUBs;HATs acetylate histones;TGF_beta_Receptor;Deubiquitination;Signaling by Nuclear Receptors;Chromatin organization;Estrogen-dependent gene expression;Constitutive Signaling by NOTCH1 PEST Domain Mutants;Signaling by NOTCH1 PEST Domain Mutants in Cancer;Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants;Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer;Signaling by NOTCH1 in Cancer;ESR-mediated signaling;Transcriptional regulation by RUNX1;Diseases of signal transduction;Retinoic acid receptors-mediated signaling;Regulation of Androgen receptor activity;Signaling events mediated by HDAC Class III;FoxO family signaling;NOTCH1 Intracellular Domain Regulates Transcription;Signaling events mediated by HDAC Class I;Regulation of nuclear SMAD2/3 signaling;E2F transcription factor network;p53 pathway (Consensus)

Recessive Scores

• pRec: 0.629

Intolerance Scores

• loftool: 0.458
• rvis_EVS: -0.33
• rvis_percentile_EVS: 30.7

Haploinsufficiency Scores

• pHI: 0.997
• hipred: Y
• hipred_score: 0.792
• ghis: 0.555

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 1.00

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Kat2b
• Phenotype: growth/size/body region phenotype; embryo phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype

Zebrafish Information Network

• Gene name: kat2b
• Affected structure: paired fin
• Phenotype tag: abnormal
• Phenotype quality: decreased size

Gene ontology

• Biological process: chromatin remodeling;transcription initiation from RNA polymerase II promoter;protein acetylation;cell cycle arrest;Notch signaling pathway;positive regulation of transcription of Notch receptor target;heart development;negative regulation of cell population proliferation;regulation of protein ADP-ribosylation;viral process;N-terminal peptidyl-lysine acetylation;internal peptidyl-lysine acetylation;peptidyl-lysine acetylation;cellular response to insulin stimulus;positive regulation of gluconeogenesis by positive regulation of transcription from RNA polymerase II promoter;histone H3 acetylation;histone H3-K9 acetylation;regulation of megakaryocyte differentiation;negative regulation of cyclin-dependent protein serine/threonine kinase activity;positive regulation of Notch signaling pathway;positive regulation of gene expression, epigenetic;positive regulation of transcription by RNA polymerase II;negative regulation of centriole replication;rhythmic process;limb development
• Cellular component: PCAF complex;kinetochore;nucleus;nucleoplasm;Ada2/Gcn5/Ada3 transcription activator complex;centrosome;A band;I band;protein-containing complex;actomyosin
• Molecular function: RNA polymerase II regulatory region sequence-specific DNA binding;chromatin binding;transcription coregulator activity;transcription coactivator activity;histone acetyltransferase activity;lysine N-acetyltransferase activity, acting on acetyl phosphate as donor;cyclin-dependent protein serine/threonine kinase inhibitor activity;protein binding;transcription factor binding;acetyltransferase activity;protein kinase binding;histone deacetylase binding;peptide-lysine-N-acetyltransferase activity