KBTBD13
Basic information
Region (hg38): 15:65076745-65079948
Links
Phenotypes
GenCC
Source:
- nemaline myopathy 6 (Definitive), mode of inheritance: AD
- nemaline myopathy 6 (Moderate), mode of inheritance: AD
- childhood-onset nemaline myopathy (Supportive), mode of inheritance: AD
- nemaline myopathy 6 (Strong), mode of inheritance: AD
- nemaline myopathy 6 (Limited), mode of inheritance: Unknown
- nemaline myopathy 6 (Moderate), mode of inheritance: AD
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Nemaline myopathy 6 | AD | General | Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing | Musculoskeletal | 11731279; 21104864; 21109227 |
ClinVar
This is a list of variants' phenotypes submitted to
- Nemaline myopathy 6 (497 variants)
- not provided (61 variants)
- not specified (38 variants)
- Inborn genetic diseases (35 variants)
- Nemaline Myopathy, Dominant (7 variants)
- Actin accumulation myopathy (1 variants)
- KBTBD13-related condition (1 variants)
- See cases (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the KBTBD13 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 10 | 119 | 10 | 139 | ||
missense | 235 | 44 | 18 | 299 | ||
nonsense | 10 | 10 | ||||
start loss | 2 | |||||
frameshift | 15 | 17 | ||||
inframe indel | 3 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region ? | 0 | |||||
non coding ? | 17 | 12 | 37 | |||
Total | 1 | 1 | 290 | 174 | 41 |
Variants in KBTBD13
This is a list of pathogenic ClinVar variants found in the KBTBD13 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G | Nemaline myopathy 6 | Uncertain significance (Aug 09, 2022) | ||
15-65076799-C-T | not specified | Likely benign (Jul 28, 2017) | ||
15-65076800-G-A | not specified | Likely benign (Apr 10, 2017) | ||
15-65076803-C-T | not specified • Nemaline Myopathy, Dominant | Benign/Likely benign (Jun 14, 2016) | ||
15-65076813-G-A | KBTBD13-related disorder | Likely benign (Dec 21, 2022) | ||
15-65076817-T-A | Likely benign (Jul 10, 2018) | |||
15-65076817-T-G | Nemaline myopathy 6 | Conflicting classifications of pathogenicity (Jan 18, 2024) | ||
15-65076822-C-T | Nemaline Myopathy, Dominant | Likely benign (Jun 14, 2016) | ||
15-65076823-G-A | Nemaline myopathy 6 | Uncertain significance (Jan 14, 2022) | ||
15-65076826-G-A | Nemaline myopathy 6 | Uncertain significance (Jun 08, 2022) | ||
15-65076828-C-G | Nemaline myopathy 6 | Uncertain significance (Nov 26, 2019) | ||
15-65076829-C-CA | Uncertain significance (Jan 08, 2018) | |||
15-65076831-C-G | Nemaline myopathy 6 | Uncertain significance (Jul 06, 2022) | ||
15-65076836-C-T | Nemaline myopathy 6 | Likely benign (Jun 09, 2023) | ||
15-65076838-T-C | Nemaline myopathy 6 | Uncertain significance (May 23, 2022) | ||
15-65076839-G-A | Nemaline myopathy 6 | Likely benign (Oct 12, 2022) | ||
15-65076840-G-T | Nemaline myopathy 6 | Uncertain significance (Apr 17, 2022) | ||
15-65076842-G-A | Nemaline myopathy 6 | Conflicting classifications of pathogenicity (Jan 10, 2024) | ||
15-65076846-G-A | Nemaline myopathy 6 | Uncertain significance (Apr 15, 2023) | ||
15-65076849-T-G | Nemaline myopathy 6 | Uncertain significance (Nov 24, 2023) | ||
15-65076855-G-A | Nemaline myopathy 6 | Uncertain significance (Jul 18, 2023) | ||
15-65076858-G-A | Nemaline myopathy 6 • Inborn genetic diseases | Conflicting classifications of pathogenicity (May 15, 2023) | ||
15-65076859-G-A | Nemaline myopathy 6 | Uncertain significance (Jan 15, 2021) | ||
15-65076868-T-G | Nemaline myopathy 6 | Likely benign (Apr 08, 2020) | ||
15-65076873-G-C | Nemaline myopathy 6 • Inborn genetic diseases | Conflicting classifications of pathogenicity (Jan 04, 2024) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
KBTBD13 | protein_coding | protein_coding | ENST00000432196 | 1 | 3123 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
2.26e-10 | 0.0204 | 0 | 0 | 0 | 0 | 0.00 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | -0.587 | 307 | 279 | 1.10 | 0.0000220 | 2765 |
Missense in Polyphen | 94 | 92.834 | 1.0126 | 1011 | ||
Synonymous | -1.44 | 168 | 146 | 1.15 | 0.0000135 | 997 |
Loss of Function | -0.915 | 13 | 9.89 | 1.31 | 5.12e-7 | 99 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00 | 0.00 |
Ashkenazi Jewish | 0.00 | 0.00 |
East Asian | 0.00 | 0.00 |
Finnish | 0.00 | 0.00 |
European (Non-Finnish) | 0.00 | 0.00 |
Middle Eastern | 0.00 | 0.00 |
South Asian | 0.00 | 0.00 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex. {ECO:0000269|PubMed:22542517}.;
- Disease
- DISEASE: Nemaline myopathy 6 (NEM6) [MIM:609273]: A form of nemaline myopathy characterized by childhood onset of slowly progressive proximal muscle weakness, exercise intolerance, and slow movements with stiff muscles. Patients are unable to run or correct themselves from falling over. {ECO:0000269|PubMed:21109227}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Post-translational protein modification;Metabolism of proteins;Immune System;Adaptive Immune System;Antigen processing: Ubiquitination & Proteasome degradation;Class I MHC mediated antigen processing & presentation;Neddylation
(Consensus)
Haploinsufficiency Scores
- pHI
- hipred
- N
- hipred_score
- 0.389
- ghis
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.114
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Kbtbd13
- Phenotype
Gene ontology
- Biological process
- protein ubiquitination;post-translational protein modification
- Cellular component
- cytosol
- Molecular function