KBTBD13

kelch repeat and BTB domain containing 13, the group of BTB domain containing

Basic information

Region (hg38): 15:65076745-65079948

Links

ENSG00000234438 ∙ NCBI:390594 ∙ OMIM:613727 ∙ HGNC:37227 ∙ Uniprot:C9JR72 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• nemaline myopathy 6 (Definitive), mode of inheritance: AD
• nemaline myopathy 6 (Moderate), mode of inheritance: AD
• childhood-onset nemaline myopathy (Supportive), mode of inheritance: AD
• nemaline myopathy 6 (Strong), mode of inheritance: AD
• nemaline myopathy 6 (Limited), mode of inheritance: Unknown
• nemaline myopathy 6 (Moderate), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Nemaline myopathy 6	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Musculoskeletal	11731279; 21104864; 21109227

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KBTBD13 gene.

• Nemaline myopathy 6 (497 variants)
• not provided (61 variants)
• not specified (38 variants)
• Inborn genetic diseases (35 variants)
• Nemaline Myopathy, Dominant (7 variants)
• Actin accumulation myopathy (1 variants)
• KBTBD13-related condition (1 variants)
• See cases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KBTBD13 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			10	119	10	139
missense	1	1	235	44	18	299
nonsense			10			10
start loss			1	1		2
frameshift			15	1	1	17
inframe indel			2	1		3
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			17	8	12	37
Total	1	1	290	174	41

Variants in KBTBD13

This is a list of pathogenic ClinVar variants found in the KBTBD13 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
15-65076794-GCCTCCGCCCGGCCAGCTCGCCATGGCACGGGGTCCACAGACCCTGGTGCAGGTGTGGGTGGGCGGCCAGCTCTTCCAAGCCGACCGCGCCCTGCTGGTGGAGCACTGTGGCTTCTTCCGAGGCCTCTTCCGCTCCGGCATGCGGGAGACCCGCGCAGCAGAGGTGCGCCTGGGCGTTCTGAGCGCGGGAGGTTTCCGCGCCACGCTGCAGGTGCTGCGCGGCGACCGGCCGGCGCTGGCGGCGGAGGACGAGCTGCTGCAGGCCGTGGAGTGCGCCGCCTTCCTC-G		Nemaline myopathy 6	Uncertain significance (Aug 09, 2022)
15-65076799-C-T		not specified	Likely benign (Jul 28, 2017)
15-65076800-G-A		not specified	Likely benign (Apr 10, 2017)
15-65076803-C-T		not specified • Nemaline Myopathy, Dominant	Benign/Likely benign (Jun 14, 2016)
15-65076813-G-A		KBTBD13-related disorder	Likely benign (Dec 21, 2022)
15-65076817-T-A			Likely benign (Jul 10, 2018)
15-65076817-T-G		Nemaline myopathy 6	Conflicting classifications of pathogenicity (Jan 18, 2024)
15-65076822-C-T		Nemaline Myopathy, Dominant	Likely benign (Jun 14, 2016)
15-65076823-G-A		Nemaline myopathy 6	Uncertain significance (Jan 14, 2022)
15-65076826-G-A		Nemaline myopathy 6	Uncertain significance (Jun 08, 2022)
15-65076828-C-G		Nemaline myopathy 6	Uncertain significance (Nov 26, 2019)
15-65076829-C-CA			Uncertain significance (Jan 08, 2018)
15-65076831-C-G		Nemaline myopathy 6	Uncertain significance (Jul 06, 2022)
15-65076836-C-T		Nemaline myopathy 6	Likely benign (Jun 09, 2023)
15-65076838-T-C		Nemaline myopathy 6	Uncertain significance (May 23, 2022)
15-65076839-G-A		Nemaline myopathy 6	Likely benign (Oct 12, 2022)
15-65076840-G-T		Nemaline myopathy 6	Uncertain significance (Apr 17, 2022)
15-65076842-G-A		Nemaline myopathy 6	Conflicting classifications of pathogenicity (Jan 10, 2024)
15-65076846-G-A		Nemaline myopathy 6	Uncertain significance (Apr 15, 2023)
15-65076849-T-G		Nemaline myopathy 6	Uncertain significance (Nov 24, 2023)
15-65076855-G-A		Nemaline myopathy 6	Uncertain significance (Jul 18, 2023)
15-65076858-G-A		Nemaline myopathy 6 • Inborn genetic diseases	Conflicting classifications of pathogenicity (May 15, 2023)
15-65076859-G-A		Nemaline myopathy 6	Uncertain significance (Jan 15, 2021)
15-65076868-T-G		Nemaline myopathy 6	Likely benign (Apr 08, 2020)
15-65076873-G-C		Nemaline myopathy 6 • Inborn genetic diseases	Conflicting classifications of pathogenicity (Jan 04, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KBTBD13	protein_coding	protein_coding	ENST00000432196	1	3123

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.26e-10	0.0204	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.587	307	279	1.10	0.0000220	2765
Missense in Polyphen		94	92.834	1.0126		1011
Synonymous	-1.44	168	146	1.15	0.0000135	997
Loss of Function	-0.915	13	9.89	1.31	5.12e-7	99

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Substrate-specific adapter of a BCR (BTB-CUL3-RBX1) E3 ubiquitin ligase complex. {ECO:0000269|PubMed:22542517}.
• Disease: DISEASE: Nemaline myopathy 6 (NEM6) [MIM:609273]: A form of nemaline myopathy characterized by childhood onset of slowly progressive proximal muscle weakness, exercise intolerance, and slow movements with stiff muscles. Patients are unable to run or correct themselves from falling over. {ECO:0000269|PubMed:21109227}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Post-translational protein modification;Metabolism of proteins;Immune System;Adaptive Immune System;Antigen processing: Ubiquitination & Proteasome degradation;Class I MHC mediated antigen processing & presentation;Neddylation (Consensus)

Haploinsufficiency Scores

• hipred: N
• hipred_score: 0.389

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.114

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Kbtbd13

Gene ontology

• Biological process: protein ubiquitination;post-translational protein modification
• Cellular component: cytosol