KCNJ6

potassium inwardly rectifying channel subfamily J member 6, the group of Potassium inwardly rectifying channel subfamily J

Basic information

Region (hg38): 21:37607372-38121345

Previous symbols: [ "KCNJ7" ]

Links

ENSG00000157542 ∙ NCBI:3763 ∙ OMIM:600877 ∙ HGNC:6267 ∙ Uniprot:P48051 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Keppen-Lubinsky syndrome (Strong), mode of inheritance: AD
• Keppen-Lubinsky syndrome (Moderate), mode of inheritance: AD
• Keppen-Lubinsky syndrome (Strong), mode of inheritance: AD
• Keppen-Lubinsky syndrome (Supportive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Keppen-Lubinsky syndrome	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Endocrine; Neurologic	12567423; 19610118; 25620207

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KCNJ6 gene.

• not provided (69 variants)
• Keppen-Lubinsky syndrome (8 variants)
• Inborn genetic diseases (8 variants)
• See cases (2 variants)
• KCNJ6-related condition (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KCNJ6 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				22	5	27
missense		2	31	1		34
nonsense			3			3
start loss			1			1
frameshift			1			1
inframe indel			1			1
splice donor/acceptor (+/-2bp)						0
splice region				3		3
non coding			1	3	7	11
Total	0	2	38	26	12

Variants in KCNJ6

This is a list of pathogenic ClinVar variants found in the KCNJ6 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
21-37625125-G-C			Benign (May 20, 2021)
21-37625188-C-T		Inborn genetic diseases	Uncertain significance (Mar 29, 2023)
21-37625218-C-T			Uncertain significance (Oct 13, 2023)
21-37625254-C-A		Inborn genetic diseases	Uncertain significance (Jan 03, 2022)
21-37625257-G-A			Uncertain significance (Jan 15, 2022)
21-37625258-T-C			Benign (Jul 31, 2023)
21-37625278-C-A		Inborn genetic diseases	Uncertain significance (Aug 14, 2023)
21-37625289-A-G		not specified	Uncertain significance (Feb 19, 2024)
21-37625299-C-T		Inborn genetic diseases	Uncertain significance (Feb 11, 2021)
21-37625303-C-A			Uncertain significance (Aug 16, 2022)
21-37625306-G-C			Uncertain significance (Jul 22, 2023)
21-37625309-G-A		not specified	Likely benign (Mar 05, 2024)
21-37625318-G-A			Likely benign (Sep 09, 2023)
21-37625390-G-A			Likely benign (Nov 27, 2023)
21-37625399-G-A		Keppen-Lubinsky syndrome	Benign (Jan 30, 2024)
21-37625410-T-A			Uncertain significance (Jun 25, 2023)
21-37625420-T-G			Likely benign (Nov 27, 2023)
21-37625456-G-GT			Uncertain significance (Oct 07, 2019)
21-37625461-A-G			Uncertain significance (Jul 17, 2023)
21-37625467-G-A			Uncertain significance (Nov 03, 2021)
21-37625491-A-G			Likely benign (Nov 24, 2023)
21-37625500-T-A			Likely benign (Jun 01, 2021)
21-37625563-G-A			Benign (May 01, 2021)
21-37632245-A-AGGCCGGGCCGGAAGCGCGTTGGCCACGCCTGTCAGCCCCGCACTTTGGAGCCGTTAGGCGGGTGTATCATGAGGTCCGAGATCGCAGACACCATATCCTGTCTCACAACAAGGTGACCCCCCTCCTCTACTAAAAACTCCACACATTAGCCGGGCGCAGTGGCGGGCGCCTGTAGTTCCCAGCTACTCCGGGCAGGCTAGAGGACAGGAGAAATAGAGTGCGTGCACCCCGGCCAGCGGAGCTTGCAGCTGGCGCACTAGATTGCGCCACTGCAGTCCGCCGTCGCGGCCTAGGGCCGACAGAGCGAGAACTCCGTCTCCAACAACAAAAAACACACACCACAAACAAAC		Schizophrenia	Uncertain significance (Nov 11, 2022)
21-37714194-G-A			Benign (Jun 22, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KCNJ6	protein_coding	protein_coding	ENST00000609713	3	309072

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.541	0.459	124788	0	12	124800	0.0000481

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.71	78	240	0.325	0.0000135	2788
Missense in Polyphen		15	116.99	0.12821		1349
Synonymous	1.11	86	100	0.858	0.00000632	832
Loss of Function	2.90	3	15.2	0.197	8.05e-7	172

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000659	0.0000645
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.0000939	0.0000928
European (Non-Finnish)	0.0000534	0.0000530
Middle Eastern	0.00	0.00
South Asian	0.0000327	0.0000327
Other	0.000334	0.000330

dbNSFP

Source: dbNSFP

• Function: FUNCTION: This potassium channel may be involved in the regulation of insulin secretion by glucose and/or neurotransmitters acting through G-protein-coupled receptors. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium.
• Pathway: Oxytocin signaling pathway - Homo sapiens (human);Retrograde endocannabinoid signaling - Homo sapiens (human);GABAergic synapse - Homo sapiens (human);Serotonergic synapse - Homo sapiens (human);Dopaminergic synapse - Homo sapiens (human);Circadian entrainment - Homo sapiens (human);Estrogen signaling pathway - Homo sapiens (human);Cholinergic synapse - Homo sapiens (human);Morphine addiction - Homo sapiens (human);Splicing factor NOVA regulated synaptic proteins;Neuronal System;Inhibition of voltage gated Ca2+ channels via Gbeta/gamma subunits;Activation of GABAB receptors;GABA B receptor activation;GABA receptor activation;Neurotransmitter receptors and postsynaptic signal transmission;Transmission across Chemical Synapses;Activation of G protein gated Potassium channels;G protein gated Potassium channels;Inwardly rectifying K+ channels;Potassium Channels (Consensus)

Recessive Scores

• pRec: 0.216

Intolerance Scores

• loftool: 0.0386
• rvis_EVS: -0.36
• rvis_percentile_EVS: 28.63

Haploinsufficiency Scores

• pHI: 0.377
• hipred: Y
• hipred_score: 0.725
• ghis: 0.466

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.876

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Kcnj6
• Phenotype: reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); growth/size/body region phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; cellular phenotype; muscle phenotype

Gene ontology

• Biological process: potassium ion transport;regulation of ion transmembrane transport;potassium ion import across plasma membrane
• Cellular component: Golgi apparatus;plasma membrane;voltage-gated potassium channel complex
• Molecular function: inward rectifier potassium channel activity;protein binding;G-protein activated inward rectifier potassium channel activity