KCNQ1-AS1

KCNQ1 antisense RNA 1, the group of Antisense RNAs

Basic information

Region (hg38): 11:2840135-2871662

Links

ENSG00000229414 ∙ NCBI:338653 ∙ ∙ HGNC:42790 ∙ ∙ ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KCNQ1-AS1 gene.

• Long QT syndrome (107 variants)
• Cardiac arrhythmia (62 variants)
• Long QT syndrome 1 (57 variants)
• not provided (54 variants)
• Congenital long QT syndrome (52 variants)
• Cardiovascular phenotype (52 variants)
• Jervell and Lange-Nielsen syndrome 1 (52 variants)
• Short QT syndrome type 2 (50 variants)
• Atrial fibrillation, familial, 3 (49 variants)
• not specified (22 variants)
• Jervell and Lange-Nielsen syndrome (12 variants)
• Short QT syndrome (12 variants)
• Familial atrial fibrillation (12 variants)
• Short QT syndrome type 2;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (2 variants)
• Jervell and Lange-Nielsen syndrome 1;Long QT syndrome 1;Short QT syndrome type 2;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome (2 variants)
• Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (1 variants)
• Jervell and Lange-Nielsen syndrome 1;Long QT syndrome 1;Short QT syndrome type 2;Atrial fibrillation, familial, 3 (1 variants)
• Jervell and Lange-Nielsen syndrome 1;Atrial fibrillation, familial, 3;Long QT syndrome 1;Short QT syndrome type 2;Beckwith-Wiedemann syndrome (1 variants)
• KCNQ1-Related Disorders (1 variants)
• Jervell and Lange-Nielsen syndrome 1;Short QT syndrome type 2;Long QT syndrome 1;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome (1 variants)
• Jervell and Lange-Nielsen syndrome 1;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Atrial fibrillation, familial, 3;Long QT syndrome 1 (1 variants)
• Brugada syndrome (1 variants)
• Polymorphic ventricular tachycardia (1 variants)
• Jervell and Lange-Nielsen syndrome 1;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Long QT syndrome 1 (1 variants)
• Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KCNQ1-AS1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense						0
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding	2	7	97	77	12	195
Total	2	7	97	77	12

Variants in KCNQ1-AS1

This is a list of pathogenic ClinVar variants found in the KCNQ1-AS1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
11-2847469-A-G			Benign (Jun 14, 2018)
11-2847518-A-G			Benign (Jun 26, 2018)
11-2847638-G-A			Benign (Jun 26, 2018)
11-2847648-T-C			Benign (Jun 14, 2018)
11-2847747-G-A		Long QT syndrome	Likely benign (Oct 07, 2023)
11-2847750-T-C		not specified	Likely benign (Nov 12, 2015)
11-2847753-C-A		Long QT syndrome	Uncertain significance (Apr 10, 2023)
11-2847753-C-G		Long QT syndrome	Conflicting classifications of pathogenicity (Dec 22, 2023)
11-2847757-G-A		Long QT syndrome • Cardiac arrhythmia • Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Jervell and Lange-Nielsen syndrome 1;Long QT syndrome 1;Short QT syndrome type 2	Likely benign (Apr 25, 2022)
11-2847761-C-T		Cardiac arrhythmia • Long QT syndrome	Likely benign (Jun 18, 2022)
11-2847762-C-A		Long QT syndrome	Uncertain significance (Mar 13, 2022)
11-2847762-C-T		not specified • Cardiac arrhythmia • Long QT syndrome • KCNQ1-related disorder	Likely benign (Nov 24, 2023)
11-2847761-C-CCGCAGGTGA		Long QT syndrome	Uncertain significance (Feb 20, 2018)
11-2847763-G-A		not specified • Long QT syndrome • Cardiac arrhythmia • KCNQ1-related disorder	Conflicting classifications of pathogenicity (May 06, 2024)
11-2847764-C-T		Long QT syndrome	Uncertain significance (Apr 25, 2023)
11-2847765-A-G		Jervell and Lange-Nielsen syndrome 1 • Cardiovascular phenotype • Long QT syndrome	Conflicting classifications of pathogenicity (Aug 13, 2022)
11-2847767-G-C		Long QT syndrome	Uncertain significance (Jan 17, 2024)
11-2847767-G-T		Cardiac arrhythmia	Uncertain significance (Sep 27, 2019)
11-2847771-C-T		Congenital long QT syndrome • Long QT syndrome • Cardiovascular phenotype • Cardiac arrhythmia • KCNQ1-related disorder • not specified	Conflicting classifications of pathogenicity (Jul 08, 2024)
11-2847772-G-A		not specified • Long QT syndrome • Cardiovascular phenotype • Atrial fibrillation, familial, 3 • Long QT syndrome 1 • Jervell and Lange-Nielsen syndrome 1 • Short QT syndrome type 2 • Cardiac arrhythmia	Conflicting classifications of pathogenicity (Jul 01, 2024)
11-2847773-C-T		Long QT syndrome	Pathogenic (Jul 25, 2023)
11-2847777-T-C		Congenital long QT syndrome	not provided (-)
11-2847776-CTGGACCAGAGGCTGGCACTCATCACCGACATGCTTCACCAGCTGCTCTCCTTGCACGGTGGCAGCACCCCCGGCAGCGGCGGCCCCCCCAGAGAGGGCGGGGCCCACATCACCCAGCCCTGCGGCAGTGGCGGCTCCGTCGACCCTGAGCTCTTCCTGCCCAGCAACACCCTGCCCACCTACGAGCAGCTGACCGTGCCCAGGAGGGGCCCCGATGAGGGGTCCTGAGGAGGGGATGGGGCTGGGGGATGGGCCTGAGTGAGAGGGGAGGCCAAGAGTGGCCCCACCTGGCCCTCTCTGAAGGAGGCCACCTCCTAAAAGGCCCAGAGAGAAGAGCCCCACTCTCAGAGGCCCCAATACCCCA-C		Atrial fibrillation, familial, 3;Long QT syndrome 1;Short QT syndrome type 2	Likely pathogenic (Aug 23, 2021)
11-2847778-G-A		not specified • Cardiovascular phenotype • Long QT syndrome	Likely benign (Jan 15, 2024)
11-2847780-A-AC		Long QT syndrome • Cardiac arrhythmia	Conflicting classifications of pathogenicity (Nov 05, 2021)

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP