KCNQ1-AS1
Basic information
Region (hg38): 11:2840135-2871662
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
- Long QT syndrome (107 variants)
- Cardiac arrhythmia (62 variants)
- Long QT syndrome 1 (57 variants)
- not provided (54 variants)
- Congenital long QT syndrome (52 variants)
- Cardiovascular phenotype (52 variants)
- Jervell and Lange-Nielsen syndrome 1 (52 variants)
- Short QT syndrome type 2 (50 variants)
- Atrial fibrillation, familial, 3 (49 variants)
- not specified (22 variants)
- Jervell and Lange-Nielsen syndrome (12 variants)
- Short QT syndrome (12 variants)
- Familial atrial fibrillation (12 variants)
- Short QT syndrome type 2;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (2 variants)
- Jervell and Lange-Nielsen syndrome 1;Long QT syndrome 1;Short QT syndrome type 2;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome (2 variants)
- Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (1 variants)
- Jervell and Lange-Nielsen syndrome 1;Long QT syndrome 1;Short QT syndrome type 2;Atrial fibrillation, familial, 3 (1 variants)
- Jervell and Lange-Nielsen syndrome 1;Atrial fibrillation, familial, 3;Long QT syndrome 1;Short QT syndrome type 2;Beckwith-Wiedemann syndrome (1 variants)
- KCNQ1-Related Disorders (1 variants)
- Jervell and Lange-Nielsen syndrome 1;Short QT syndrome type 2;Long QT syndrome 1;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome (1 variants)
- Jervell and Lange-Nielsen syndrome 1;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Atrial fibrillation, familial, 3;Long QT syndrome 1 (1 variants)
- Brugada syndrome (1 variants)
- Polymorphic ventricular tachycardia (1 variants)
- Jervell and Lange-Nielsen syndrome 1;Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Long QT syndrome 1 (1 variants)
- Atrial fibrillation, familial, 3;Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1 (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the KCNQ1-AS1 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 0 | |||||
missense | 0 | |||||
nonsense | 0 | |||||
start loss | 0 | |||||
frameshift | 0 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region | 0 | |||||
non coding | 97 | 77 | 12 | 195 | ||
Total | 2 | 7 | 97 | 77 | 12 |
Variants in KCNQ1-AS1
This is a list of pathogenic ClinVar variants found in the KCNQ1-AS1 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
11-2847469-A-G | Benign (Jun 14, 2018) | |||
11-2847518-A-G | Benign (Jun 26, 2018) | |||
11-2847638-G-A | Benign (Jun 26, 2018) | |||
11-2847648-T-C | Benign (Jun 14, 2018) | |||
11-2847747-G-A | Long QT syndrome | Likely benign (Oct 26, 2024) | ||
11-2847750-T-C | not specified | Likely benign (Nov 12, 2015) | ||
11-2847753-C-A | Long QT syndrome | Uncertain significance (Apr 10, 2023) | ||
11-2847753-C-G | Long QT syndrome | Conflicting classifications of pathogenicity (Dec 22, 2023) | ||
11-2847757-G-A | Cardiac arrhythmia • Long QT syndrome • Beckwith-Wiedemann syndrome;Short QT syndrome type 2;Long QT syndrome 1;Jervell and Lange-Nielsen syndrome 1;Atrial fibrillation, familial, 3 | Likely benign (Oct 21, 2024) | ||
11-2847761-C-T | Cardiac arrhythmia • Long QT syndrome | Likely benign (Mar 11, 2024) | ||
11-2847762-C-A | Long QT syndrome | Uncertain significance (Mar 13, 2022) | ||
11-2847762-C-T | not specified • Cardiac arrhythmia • Long QT syndrome • KCNQ1-related disorder | Likely benign (Nov 24, 2023) | ||
11-2847761-C-CCGCAGGTGA | Long QT syndrome | Uncertain significance (Oct 22, 2024) | ||
11-2847763-G-A | not specified • Long QT syndrome • Cardiac arrhythmia • KCNQ1-related disorder | Likely benign (Apr 23, 2025) | ||
11-2847764-C-T | Long QT syndrome • Cardiac arrhythmia | Conflicting classifications of pathogenicity (Nov 18, 2024) | ||
11-2847765-A-G | Long QT syndrome • Jervell and Lange-Nielsen syndrome 1 • Cardiovascular phenotype | Conflicting classifications of pathogenicity (Aug 13, 2022) | ||
11-2847767-G-C | Long QT syndrome | Uncertain significance (Aug 27, 2024) | ||
11-2847767-G-T | Cardiac arrhythmia | Uncertain significance (Sep 27, 2019) | ||
11-2847771-C-T | Congenital long QT syndrome • Long QT syndrome • Cardiovascular phenotype • Cardiac arrhythmia • KCNQ1-related disorder • not specified | Conflicting classifications of pathogenicity (Feb 02, 2025) | ||
11-2847772-G-A | not specified • Long QT syndrome • Cardiovascular phenotype • Long QT syndrome 1 • Jervell and Lange-Nielsen syndrome 1 • Atrial fibrillation, familial, 3 • Short QT syndrome type 2 • Cardiac arrhythmia | Conflicting classifications of pathogenicity (Jan 29, 2025) | ||
11-2847773-C-T | Long QT syndrome | Pathogenic (Jul 25, 2023) | ||
11-2847777-T-C | Congenital long QT syndrome | not provided (-) | ||
11-2847776-CTGGACCAGAGGCTGGCACTCATCACCGACATGCTTCACCAGCTGCTCTCCTTGCACGGTGGCAGCACCCCCGGCAGCGGCGGCCCCCCCAGAGAGGGCGGGGCCCACATCACCCAGCCCTGCGGCAGTGGCGGCTCCGTCGACCCTGAGCTCTTCCTGCCCAGCAACACCCTGCCCACCTACGAGCAGCTGACCGTGCCCAGGAGGGGCCCCGATGAGGGGTCCTGAGGAGGGGATGGGGCTGGGGGATGGGCCTGAGTGAGAGGGGAGGCCAAGAGTGGCCCCACCTGGCCCTCTCTGAAGGAGGCCACCTCCTAAAAGGCCCAGAGAGAAGAGCCCCACTCTCAGAGGCCCCAATACCCCA-C | Atrial fibrillation, familial, 3;Short QT syndrome type 2;Long QT syndrome 1 | Likely pathogenic (Aug 23, 2021) | ||
11-2847778-G-A | Cardiovascular phenotype • Long QT syndrome | Conflicting classifications of pathogenicity (Jan 06, 2025) | ||
11-2847780-A-AC | Cardiac arrhythmia • Long QT syndrome | Conflicting classifications of pathogenicity (Nov 05, 2021) |
GnomAD
Source:
dbNSFP
Source: