KIT
Basic information
Region (hg38): 4:54657267-54740783
Previous symbols: [ "PBT" ]
Links
Phenotypes
GenCC
Source:
- piebaldism (Strong), mode of inheritance: AD
- gastrointestinal stromal tumor (Strong), mode of inheritance: AD
- mastocytosis (Strong), mode of inheritance: AD
- piebaldism (Strong), mode of inheritance: AD
- piebaldism (Definitive), mode of inheritance: AD
- mastocytosis (Moderate), mode of inheritance: AD
- piebaldism (Supportive), mode of inheritance: AD
- gastrointestinal stromal tumor (Supportive), mode of inheritance: AD
- piebaldism (Definitive), mode of inheritance: AD
- gastrointestinal stromal tumor (Strong), mode of inheritance: AD
- cutaneous mastocytosis (Strong), mode of inheritance: AD
- piebaldism (Strong), mode of inheritance: AD
- gastrointestinal stromal tumor (Definitive), mode of inheritance: AD
- gastrointestinal stromal tumor (Strong), mode of inheritance: AD
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Gastrointestinal stromal tumor, familial; Mastocytosis, cutaneous | AD | Oncologic | For Gastrointestinal stromal tumor, surveillance may allow early diagnosis and treatment of gastrointestinal stromal tumors (including with tyrosine kinase inhibitors such as imatinib), which may improve outcomes | Dermatologic; Oncologic | 1717985; 9697690; 11073817; 11505412; 11174389; 15173254; 16143141; 16183119; 16185297; 17824795; 18724244; 18183595; 19847891; 21689725; 22083669 |
ClinVar
This is a list of variants' phenotypes submitted to
- Gastrointestinal stromal tumor (32 variants)
- not provided (6 variants)
- Piebaldism (3 variants)
- Dysgerminoma (1 variants)
- Germ cell tumor of testis (1 variants)
- B Lymphoblastic Leukemia/Lymphoma with t(v;11q23.3); KMT2A Rearranged (1 variants)
- Hereditary cancer-predisposing syndrome (1 variants)
- Gastrointestinal stromal tumor, familial (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the KIT gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 667 | 675 | ||||
missense | 16 | 1306 | 1335 | |||
nonsense | 15 | |||||
start loss | 1 | |||||
frameshift | 24 | 31 | ||||
inframe indel | 17 | 26 | ||||
splice donor/acceptor (+/-2bp) | 12 | 18 | ||||
splice region | 1 | 78 | 131 | 1 | 211 | |
non coding | 35 | 363 | 44 | 442 | ||
Total | 39 | 41 | 1377 | 1040 | 46 |
Variants in KIT
This is a list of pathogenic ClinVar variants found in the KIT region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
4-54657771-G-A | Benign (Jun 22, 2018) | |||
4-54657917-C-CCGCTCGCGGCTCTGGGGGCTCGGCTTTGCCGCGCTCGCTGCACTTGGGCGAGAGCTGGAACGTGGACCAGAGCTCGGATCCCATCGCAGCTACCGCGATGAGAGG | Gastrointestinal stromal tumor | Uncertain significance (Nov 20, 2024) | ||
4-54657959-A-C | Piebaldism • Gastrointestinal stromal tumor • Mastocytosis | Uncertain significance (Jan 13, 2018) | ||
4-54657994-G-T | Piebaldism • Gastrointestinal stromal tumor • Mastocytosis | Benign/Likely benign (Jan 12, 2018) | ||
4-54658001-T-A | not specified • Piebaldism • Mastocytosis • Gastrointestinal stromal tumor | Conflicting classifications of pathogenicity (Nov 03, 2021) | ||
4-54658006-G-T | KIT-related disorder | Likely benign (Sep 26, 2022) | ||
4-54658010-C-T | Hereditary cancer-predisposing syndrome • KIT-related disorder | Conflicting classifications of pathogenicity (Jun 25, 2024) | ||
4-54658011-C-A | Hereditary cancer-predisposing syndrome | Uncertain significance (Nov 14, 2024) | ||
4-54658012-G-A | Hereditary cancer-predisposing syndrome | Uncertain significance (Apr 10, 2025) | ||
4-54658013-C-T | Hereditary cancer-predisposing syndrome | Uncertain significance (Mar 03, 2025) | ||
4-54658014-G-A | Uncertain significance (Jan 19, 2023) | |||
4-54658015-A-C | Gastrointestinal stromal tumor | Uncertain significance (Nov 19, 2024) | ||
4-54658017-G-A | Gastrointestinal stromal tumor | Uncertain significance (Dec 04, 2024) | ||
4-54658021-G-A | Gastrointestinal stromal tumor | Uncertain significance (Jul 09, 2024) | ||
4-54658021-G-C | Gastrointestinal stromal tumor • Hereditary cancer-predisposing syndrome | Uncertain significance (Mar 01, 2025) | ||
4-54658022-G-A | Gastrointestinal stromal tumor | Uncertain significance (Feb 25, 2024) | ||
4-54658022-G-T | Gastrointestinal stromal tumor | Uncertain significance (Mar 17, 2024) | ||
4-54658023-C-G | Gastrointestinal stromal tumor • Hereditary cancer-predisposing syndrome | Likely benign (Nov 11, 2024) | ||
4-54658023-C-T | Gastrointestinal stromal tumor • Hereditary cancer-predisposing syndrome | Conflicting classifications of pathogenicity (Dec 30, 2024) | ||
4-54658024-G-A | Gastrointestinal stromal tumor | Uncertain significance (Mar 27, 2022) | ||
4-54658024-G-C | Gastrointestinal stromal tumor | Uncertain significance (Apr 22, 2024) | ||
4-54658024-G-T | Hereditary cancer-predisposing syndrome • Gastrointestinal stromal tumor | Uncertain significance (Aug 24, 2024) | ||
4-54658024-GC-TT | Gastrointestinal stromal tumor • Hereditary cancer-predisposing syndrome | Uncertain significance (Feb 20, 2025) | ||
4-54658025-C-T | Gastrointestinal stromal tumor • Hereditary cancer-predisposing syndrome | Uncertain significance (May 31, 2025) | ||
4-54658026-T-C | Hereditary cancer-predisposing syndrome | Likely benign (Aug 24, 2022) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
KIT | protein_coding | protein_coding | ENST00000288135 | 21 | 82797 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.981 | 0.0191 | 125729 | 1 | 18 | 125748 | 0.0000756 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 2.58 | 375 | 544 | 0.689 | 0.0000305 | 6456 |
Missense in Polyphen | 99 | 211.76 | 0.46752 | 2516 | ||
Synonymous | -1.00 | 228 | 210 | 1.09 | 0.0000135 | 1842 |
Loss of Function | 5.30 | 8 | 47.4 | 0.169 | 0.00000238 | 605 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.000268 | 0.000268 |
Ashkenazi Jewish | 0.0000992 | 0.0000992 |
East Asian | 0.000272 | 0.000272 |
Finnish | 0.0000462 | 0.0000462 |
European (Non-Finnish) | 0.0000352 | 0.0000352 |
Middle Eastern | 0.000272 | 0.000272 |
South Asian | 0.0000327 | 0.0000327 |
Other | 0.000163 | 0.000163 |
dbNSFP
Source:
- Function
- FUNCTION: Tyrosine-protein kinase that acts as cell-surface receptor for the cytokine KITLG/SCF and plays an essential role in the regulation of cell survival and proliferation, hematopoiesis, stem cell maintenance, gametogenesis, mast cell development, migration and function, and in melanogenesis. In response to KITLG/SCF binding, KIT can activate several signaling pathways. Phosphorylates PIK3R1, PLCG1, SH2B2/APS and CBL. Activates the AKT1 signaling pathway by phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase. Activated KIT also transmits signals via GRB2 and activation of RAS, RAF1 and the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1. Promotes activation of STAT family members STAT1, STAT3, STAT5A and STAT5B. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. KIT signaling is modulated by protein phosphatases, and by rapid internalization and degradation of the receptor. Activated KIT promotes phosphorylation of the protein phosphatases PTPN6/SHP-1 and PTPRU, and of the transcription factors STAT1, STAT3, STAT5A and STAT5B. Promotes phosphorylation of PIK3R1, CBL, CRK (isoform Crk-II), LYN, MAPK1/ERK2 and/or MAPK3/ERK1, PLCG1, SRC and SHC1. {ECO:0000269|PubMed:10397721, ECO:0000269|PubMed:12444928, ECO:0000269|PubMed:12511554, ECO:0000269|PubMed:12878163, ECO:0000269|PubMed:17904548, ECO:0000269|PubMed:19265199, ECO:0000269|PubMed:21135090, ECO:0000269|PubMed:21640708, ECO:0000269|PubMed:7520444, ECO:0000269|PubMed:9528781}.;
- Disease
- DISEASE: Piebald trait (PBT) [MIM:172800]: Autosomal dominant genetic developmental abnormality of pigmentation characterized by congenital patches of white skin and hair that lack melanocytes. {ECO:0000269|PubMed:11074500, ECO:0000269|PubMed:1370874, ECO:0000269|PubMed:1376329, ECO:0000269|PubMed:1717985, ECO:0000269|PubMed:7687267, ECO:0000269|PubMed:8680409, ECO:0000269|PubMed:9450866, ECO:0000269|PubMed:9699740}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Gastrointestinal stromal tumor (GIST) [MIM:606764]: Common mesenchymal neoplasms arising in the gastrointestinal tract, most often in the stomach. They are histologically, immunohistochemically, and genetically different from typical leiomyomas, leiomyosarcomas, and schwannomas. Most GISTs are composed of a fairly uniform population of spindle-shaped cells. Some tumors are dominated by epithelioid cells or contain a mixture of spindle and epithelioid morphologies. Primary GISTs in the gastrointestinal tract commonly metastasize in the omentum and mesenteries, often as multiple nodules. However, primary tumors may also occur outside of the gastrointestinal tract, in other intra-abdominal locations, especially in the omentum and mesentery. {ECO:0000269|PubMed:11505412, ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854, ECO:0000269|PubMed:9697690}. Note=The gene represented in this entry is involved in disease pathogenesis.; DISEASE: Testicular germ cell tumor (TGCT) [MIM:273300]: A common malignancy in males representing 95% of all testicular neoplasms. TGCTs have various pathologic subtypes including: unclassified intratubular germ cell neoplasia, seminoma (including cases with syncytiotrophoblastic cells), spermatocytic seminoma, embryonal carcinoma, yolk sac tumor, choriocarcinoma, and teratoma. Note=The gene represented in this entry may be involved in disease pathogenesis.; DISEASE: Leukemia, acute myelogenous (AML) [MIM:601626]: A subtype of acute leukemia, a cancer of the white blood cells. AML is a malignant disease of bone marrow characterized by maturational arrest of hematopoietic precursors at an early stage of development. Clonal expansion of myeloid blasts occurs in bone marrow, blood, and other tissue. Myelogenous leukemias develop from changes in cells that normally produce neutrophils, basophils, eosinophils and monocytes. Note=The gene represented in this entry is involved in disease pathogenesis. Somatic mutations that lead to constitutive activation of KIT are detected in AML patients. These mutations fall into two classes, the most common being in-frame internal tandem duplications of variable length in the juxtamembrane region that disrupt the normal regulation of the kinase activity. Likewise, point mutations in the kinase domain can result in a constitutively activated kinase.;
- Pathway
- PI3K-Akt signaling pathway - Homo sapiens (human);Central carbon metabolism in cancer - Homo sapiens (human);Acute myeloid leukemia - Homo sapiens (human);Breast cancer - Homo sapiens (human);Rap1 signaling pathway - Homo sapiens (human);Ras signaling pathway - Homo sapiens (human);MAPK signaling pathway - Homo sapiens (human);Phospholipase D signaling pathway - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Hematopoietic cell lineage - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);Melanogenesis - Homo sapiens (human);Imatinib Pathway, Pharmacokinetics/Pharmacodynamics;Pathway_PA165959425;Sorafenib Pharmacodynamics;miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;miR-targeted genes in muscle cell - TarBase;Cardiac Progenitor Differentiation;Differentiation Pathway;Kit receptor signaling pathway;Imatinib and Chronic Myeloid Leukemia;Focal Adhesion-PI3K-Akt-mTOR-signaling pathway;Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors;PI3K-Akt Signaling Pathway;Ras Signaling;Disease;Signal Transduction;Gene expression (Transcription);melanocyte development and pigmentation pathway;regulation of bad phosphorylation;Generic Transcription Pathway;RNA Polymerase II Transcription;KitReceptor;IL-7 signaling;Regulation of KIT signaling;EGFR1;RAF/MAP kinase cascade;MAPK1/MAPK3 signaling;MAPK family signaling cascades;PIP3 activates AKT signaling;JAK STAT pathway and regulation;EPO signaling;C-MYB transcription factor network;Gastrin;PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling;Negative regulation of the PI3K/AKT network;TFAP2 (AP-2) family regulates transcription of growth factors and their receptors;Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors;Signaling by SCF-KIT;Constitutive Signaling by Aberrant PI3K in Cancer;PI3K/AKT Signaling in Cancer;Signaling by Receptor Tyrosine Kinases;VEGF;Intracellular signaling by second messengers;Diseases of signal transduction;Signaling events mediated by Stem cell factor receptor (c-Kit)
(Consensus)
Recessive Scores
- pRec
- 0.153
Intolerance Scores
- loftool
- 0.00227
- rvis_EVS
- -0.68
- rvis_percentile_EVS
- 15.36
Haploinsufficiency Scores
- pHI
- 0.439
- hipred
- Y
- hipred_score
- 0.851
- ghis
- 0.538
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- H
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.971
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Kit
- Phenotype
- homeostasis/metabolism phenotype; cellular phenotype; muscle phenotype; craniofacial phenotype; growth/size/body region phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); endocrine/exocrine gland phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); liver/biliary system phenotype; respiratory system phenotype; immune system phenotype; skeleton phenotype; renal/urinary system phenotype; digestive/alimentary phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); hearing/vestibular/ear phenotype; vision/eye phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); reproductive system phenotype; pigmentation phenotype; neoplasm; embryo phenotype;
Zebrafish Information Network
- Gene name
- kita
- Affected structure
- melanoblast
- Phenotype tag
- abnormal
- Phenotype quality
- decreased amount
Gene ontology
- Biological process
- MAPK cascade;activation of MAPK activity;ovarian follicle development;hematopoietic progenitor cell differentiation;myeloid progenitor cell differentiation;lymphoid progenitor cell differentiation;immature B cell differentiation;dendritic cell cytokine production;mast cell chemotaxis;regulation of transcription by RNA polymerase II;glycosphingolipid metabolic process;inflammatory response;signal transduction;transmembrane receptor protein tyrosine kinase signaling pathway;spermatogenesis;spermatid development;positive regulation of cell population proliferation;germ cell migration;regulation of cell shape;visual learning;male gonad development;positive regulation of gene expression;positive regulation of phospholipase C activity;positive regulation of phosphatidylinositol 3-kinase signaling;peptidyl-tyrosine phosphorylation;cytokine-mediated signaling pathway;stem cell population maintenance;lamellipodium assembly;hemopoiesis;B cell differentiation;T cell differentiation;erythrocyte differentiation;melanocyte differentiation;positive regulation of cell migration;positive regulation of pseudopodium assembly;actin cytoskeleton reorganization;mast cell cytokine production;somatic stem cell population maintenance;embryonic hemopoiesis;ectopic germ cell programmed cell death;hematopoietic stem cell migration;megakaryocyte development;Fc receptor signaling pathway;Kit signaling pathway;erythropoietin-mediated signaling pathway;regulation of cell population proliferation;positive regulation of tyrosine phosphorylation of STAT protein;mast cell degranulation;positive regulation of MAP kinase activity;positive regulation of MAPK cascade;pigmentation;positive regulation of phosphatidylinositol 3-kinase activity;tongue development;positive regulation of Notch signaling pathway;positive regulation of JAK-STAT cascade;response to cadmium ion;protein autophosphorylation;phosphatidylinositol phosphorylation;regulation of developmental pigmentation;somatic stem cell division;positive regulation of long-term neuronal synaptic plasticity;digestive tract development;stem cell differentiation;epithelial cell proliferation;detection of mechanical stimulus involved in sensory perception of sound;positive regulation of DNA-binding transcription factor activity;positive regulation of protein kinase B signaling;cell chemotaxis;mast cell differentiation;positive regulation of ERK1 and ERK2 cascade;mast cell proliferation;cellular response to thyroid hormone stimulus;melanocyte migration;melanocyte adhesion;positive regulation of pyloric antrum smooth muscle contraction;regulation of bile acid metabolic process;positive regulation of colon smooth muscle contraction;positive regulation of small intestine smooth muscle contraction;positive regulation of vascular smooth muscle cell differentiation
- Cellular component
- acrosomal vesicle;extracellular space;plasma membrane;integral component of plasma membrane;cell-cell junction;external side of plasma membrane;cytoplasmic side of plasma membrane;mast cell granule;receptor complex
- Molecular function
- protease binding;protein tyrosine kinase activity;transmembrane receptor protein tyrosine kinase activity;stem cell factor receptor activity;Ras guanyl-nucleotide exchange factor activity;protein binding;ATP binding;cytokine binding;protein homodimerization activity;metal ion binding;phosphatidylinositol-4,5-bisphosphate 3-kinase activity