KLKB1

kallikrein B1, the group of Kallikreins

Basic information

Region (hg38): 4:186226438-186258471

Previous symbols: [ "KLK3" ]

Links

ENSG00000164344 ∙ NCBI:3818 ∙ OMIM:229000 ∙ HGNC:6371 ∙ Uniprot:P03952 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• inherited prekallikrein deficiency (Supportive), mode of inheritance: AR
• inherited prekallikrein deficiency (Strong), mode of inheritance: AR
• inherited prekallikrein deficiency (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Prekallikrein deficiency	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Hematologic	5845778; 5420590; 694428; 6568197; 3487556; 7717377; 6918357; 15461630; 19404525

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KLKB1 gene.

• Inherited prekallikrein deficiency (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KLKB1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				5	2	7
missense		2	35	6	6	49
nonsense	1	1				2
start loss						0
frameshift		3				3
inframe indel						0
splice donor/acceptor (+/-2bp)	1		1			2
splice region					2	2
non coding					29	29
Total	2	6	36	11	37

Variants in KLKB1

This is a list of pathogenic ClinVar variants found in the KLKB1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
4-186227588-G-C		Inherited prekallikrein deficiency	Uncertain significance (Jun 04, 2021)
4-186228079-T-C			Benign (Jun 19, 2021)
4-186228217-A-C		not specified	Uncertain significance (Dec 16, 2022)
4-186228218-C-T		not specified	Uncertain significance (Jul 15, 2021)
4-186228386-G-A			Benign (Nov 12, 2018)
4-186232145-A-G		not specified	Uncertain significance (Oct 12, 2021)
4-186232178-C-A		not specified	Uncertain significance (Jan 06, 2023)
4-186232208-GCCAGATGAGGTGCACATTCCACCCAAGGTGTTTGCTATTCAGTTTTCTTCCAGCAAGTTCAATCAATGACATGGAGAAAAGGTAAAAGTTGGTATTTCATTATTGGAGAAGCTGTTTTTCAAAACTGAATCAGTTTTGTGCAGAAAGGTGTAGTATAACTGAGAGTTCTTCCTCACACGGGGTTCAAGGACCAGCTTCAGCAAAATC-G		Inherited prekallikrein deficiency	Pathogenic (Dec 06, 2022)
4-186232243-C-T			Likely benign (Jun 05, 2018)
4-186232270-A-G		not specified	Uncertain significance (May 02, 2023)
4-186232278-C-A		not specified	Uncertain significance (May 08, 2024)
4-186232357-T-C			Benign (Jun 20, 2021)
4-186233719-T-C			Benign (Jun 20, 2021)
4-186234008-C-G		not specified	Uncertain significance (May 02, 2024)
4-186234010-G-A		not specified	Uncertain significance (Apr 14, 2022)
4-186234334-G-A			Benign (Nov 12, 2018)
4-186236787-A-C		not specified	Uncertain significance (Aug 08, 2023)
4-186236789-C-T		Prekallikrein deficiency	Pathogenic (Oct 01, 2004)
4-186236819-G-A		Prekallikrein deficiency	Pathogenic (Jul 01, 2007)
4-186236877-C-G		not specified	Uncertain significance (Dec 16, 2023)
4-186236880-G-A		Prekallikrein deficiency • not specified	Benign (Oct 28, 2020)
4-186236882-A-G		not specified	Uncertain significance (Jan 17, 2023)
4-186236896-G-GT		Prekallikrein deficiency • Inherited prekallikrein deficiency • KLKB1-related disorder	Conflicting classifications of pathogenicity (Dec 23, 2022)
4-186236898-T-C		not specified	Uncertain significance (Nov 27, 2023)
4-186236930-G-A		not specified	Uncertain significance (Jul 17, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KLKB1	protein_coding	protein_coding	ENST00000264690	14	49493

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
6.29e-13	0.599	125323	0	425	125748	0.00169

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.700	302	338	0.893	0.0000173	4185
Missense in Polyphen		95	124.91	0.76054		1556
Synonymous	-1.62	141	119	1.19	0.00000624	1173
Loss of Function	1.54	24	33.6	0.714	0.00000157	424

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0155	0.0156
Ashkenazi Jewish	0.000992	0.000993
East Asian	0.000381	0.000381
Finnish	0.000139	0.000139
European (Non-Finnish)	0.00102	0.00102
Middle Eastern	0.000381	0.000381
South Asian	0.000588	0.000588
Other	0.000818	0.000815

dbNSFP

Source: dbNSFP

• Function: FUNCTION: The enzyme cleaves Lys-Arg and Arg-Ser bonds. It activates, in a reciprocal reaction, factor XII after its binding to a negatively charged surface. It also releases bradykinin from HMW kininogen and may also play a role in the renin-angiotensin system by converting prorenin into renin.
• Disease: DISEASE: Prekallikrein deficiency (PKK deficiency) [MIM:612423]: This disorder is a blood coagulation defect. {ECO:0000269|PubMed:14652634, ECO:0000269|PubMed:17598838}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Complement and coagulation cascades - Homo sapiens (human);Aminocaproic Acid Action Pathway;Tranexamic Acid Action Pathway;Urokinase Action Pathway;Reteplase Action Pathway;Streptokinase Action Pathway;Tenecteplase Action Pathway;Alteplase Action Pathway;Anistreplase Action Pathway;Aprotinin Action Pathway;Phenindione Action Pathway;Dicoumarol Action Pathway;Warfarin Action Pathway;Acenocoumarol Action Pathway;Coagulation ;Bivalirudin Action Pathway;Argatroban Action Pathway;Ardeparin Action Pathway;Heparin Action Pathway;Fondaparinux Action Pathway;Enoxaparin Action Pathway;Phenprocoumon Action Pathway;Dicumarol Action Pathway;Ximelagatran Action Pathway;Lepirudin Action Pathway;Blood Clotting Cascade;Human Complement System;Dengue-2 Interactions with Complement and Coagulation Cascades;Dengue-2 Interactions with Blood Clotting Cascade;Complement and Coagulation Cascades;intrinsic prothrombin activation pathway;Extracellular matrix organization;Activation of Matrix Metalloproteinases;Intrinsic Pathway of Fibrin Clot Formation;Hemostasis;Degradation of the extracellular matrix;Formation of Fibrin Clot (Clotting Cascade) (Consensus)

Recessive Scores

• pRec: 0.329

Intolerance Scores

• loftool: 0.161
• rvis_EVS: 1.43
• rvis_percentile_EVS: 94.98

Haploinsufficiency Scores

• pHI: 0.475
• hipred: N
• hipred_score: 0.182

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.389

Mouse Genome Informatics

• Gene name: Klkb1
• Phenotype: cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); homeostasis/metabolism phenotype

Gene ontology

• Biological process: Factor XII activation;proteolysis;blood coagulation, intrinsic pathway;extracellular matrix disassembly;zymogen activation;plasminogen activation;fibrinolysis;positive regulation of fibrinolysis
• Cellular component: extracellular region;extracellular space;plasma membrane;extracellular exosome
• Molecular function: serine-type endopeptidase activity;protein binding