KYNU
Basic information
Region (hg38): 2:142877657-143055833
Links
Phenotypes
GenCC
Source:
- encephalopathy due to hydroxykynureninuria (Limited), mode of inheritance: AR
- vertebral, cardiac, renal, and limb defects syndrome 2 (Limited), mode of inheritance: AR
- encephalopathy due to hydroxykynureninuria (Supportive), mode of inheritance: AR
- congenital vertebral-cardiac-renal anomalies syndrome (Supportive), mode of inheritance: AR
- vertebral, cardiac, renal, and limb defects syndrome 2 (Strong), mode of inheritance: AR
- encephalopathy due to hydroxykynureninuria (Strong), mode of inheritance: AR
- vertebral, cardiac, renal, and limb defects syndrome 2 (Definitive), mode of inheritance: AR
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Vertebral, cardiac, renal, and limb defects syndrome 2 | AR | Cardiovascular | The condition can involve congenital cardiac anomalies, and awareness may allow early identifcation and management | Biochemical; Cardiovascular; Musculoskeletal; Renal | 17334708; 28792876; 34200361 |
ClinVar
This is a list of variants' phenotypes submitted to
- not provided (4 variants)
- Congenital NAD deficiency disorder (4 variants)
- Vertebral, cardiac, renal, and limb defects syndrome 2 (3 variants)
- Catel-Manzke syndrome (2 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the KYNU gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 7 | |||||
missense | 43 | 49 | ||||
nonsense | 3 | |||||
start loss | 0 | |||||
frameshift | 5 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 3 | |||||
splice region | 1 | 2 | 1 | 4 | ||
non coding | 3 | |||||
Total | 7 | 8 | 43 | 6 | 6 |
Highest pathogenic variant AF is 0.0000724
Variants in KYNU
This is a list of pathogenic ClinVar variants found in the KYNU region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
2-142885361-A-T | KYNU-related disorder | Likely benign (Apr 02, 2024) | ||
2-142885393-C-T | not specified | Uncertain significance (Apr 17, 2023) | ||
2-142885401-A-G | not specified | Uncertain significance (Feb 28, 2025) | ||
2-142885411-G-A | not specified | Uncertain significance (Oct 25, 2023) | ||
2-142885427-C-T | KYNU-related disorder | Likely benign (Dec 31, 2019) | ||
2-142885441-C-T | Benign (Oct 01, 2022) | |||
2-142885452-G-A | not specified | Uncertain significance (Feb 16, 2023) | ||
2-142885488-C-T | Likely benign (Oct 02, 2018) | |||
2-142885490-C-T | Benign (Dec 31, 2019) | |||
2-142885494-A-G | not specified | Uncertain significance (Jan 20, 2025) | ||
2-142885503-T-C | not specified | Uncertain significance (May 20, 2024) | ||
2-142885509-A-T | not specified | Uncertain significance (Jan 31, 2022) | ||
2-142918608-G-T | Congenital NAD deficiency disorder • Vertebral, cardiac, renal, and limb defects syndrome 2 | Pathogenic (Dec 23, 2016) | ||
2-142918609-T-C | not specified | Uncertain significance (Oct 10, 2023) | ||
2-142918611-G-A | not specified | Uncertain significance (Feb 18, 2025) | ||
2-142918634-T-C | Likely benign (Jul 02, 2018) | |||
2-142918638-A-G | not specified | Uncertain significance (Apr 26, 2023) | ||
2-142918694-A-AT | Vertebral, cardiac, renal, and limb defects syndrome 2 | Pathogenic/Likely pathogenic (Aug 29, 2023) | ||
2-142927652-A-G | not specified | Conflicting classifications of pathogenicity (Nov 07, 2023) | ||
2-142927667-A-G | not specified | Uncertain significance (Dec 03, 2024) | ||
2-142927671-T-C | Likely benign (Nov 06, 2017) | |||
2-142927694-G-C | Catel-Manzke syndrome | Pathogenic (Jan 07, 2012) | ||
2-142927727-TGAA-T | Congenital NAD deficiency disorder • Vertebral, cardiac, renal, and limb defects syndrome 2 | Pathogenic/Likely pathogenic (Mar 06, 2024) | ||
2-142927737-TGTAG-T | KYNU-related disorder | Likely pathogenic (Jun 21, 2023) | ||
2-142954375-CTTTTATAAAAGGTGTATTTTAATTTGATGTTAGAAACAACGAACTTTAAAAATGTAATTGGCCTTAATATCTTTTTAGATTCCTTTGAAGATATACTTAGCACAAAAATATGCTCCTTGGGAATTTGACAATTGAGCTGATAATAGGATATATCATTTTTAGTTTACAGGCAAAAGCAAATGCTTCATTATTTTGTTGTTATTTACTACATCATAAAAGAAATTTAATTTTAGCTAGCTGTGTGCATCTAAGTCCAGATATCATTTGATAAAATGAGTCAAGTGGGAAAACTTCCATTTCTTTGTGATGACACATCAAATATGCCCTTATCTCTAAAGACATTAAGAATGATTGAGTGAAGTCTTCCTACTTTGTTTTTTCAGTATCTTTAGACATAGTACAAACATCTAAATTACGATATGTTTATTTTACAGGAGCCAATGAGAAAGAAATAGCCCTAATGAATGCTTTGACTGTAAATTTACATCTTCTAATGGTAAGTTTTCTTTCCCACTAATGTTTAGAACACATTCATTTACAGAATCTGATGTTTTTCTATCTTTAATTCATGAGCTTCTGGGGGTTTACTTATTTAAAAATAAATTGTGAGGTTATTTTCATTTTTACTAGGAAATGCTGGACCATGATATAATAGCTTCTTCCTAATCATGGAAGAGTTGACTCTTGAGAAGAGCTTTAGAATAATGAACAGTTCTTGTCTGGGAAAATAAAGAATAAGAGCCATAATGGGTAAATAGGCAAACTACATGCAAGCCTACAAAACAGTGATGTACAATGCTAGCAAAGCACTGACCTTTTTGGAAAGACAATTTTCTAATGGCTTCAGCAGAGTGAGTTAGTGGA-C | Vertebral, cardiac, renal, and limb defects syndrome 2 | Pathogenic (Mar 06, 2024) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
KYNU | protein_coding | protein_coding | ENST00000264170 | 13 | 164824 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
4.18e-18 | 0.00552 | 125573 | 0 | 175 | 125748 | 0.000696 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | -0.413 | 267 | 249 | 1.07 | 0.0000126 | 3032 |
Missense in Polyphen | 93 | 95.641 | 0.97239 | 1068 | ||
Synonymous | 0.829 | 79 | 88.9 | 0.888 | 0.00000456 | 878 |
Loss of Function | 0.0902 | 27 | 27.5 | 0.981 | 0.00000151 | 333 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00116 | 0.00114 |
Ashkenazi Jewish | 0.000332 | 0.000298 |
East Asian | 0.000654 | 0.000653 |
Finnish | 0.000382 | 0.000370 |
European (Non-Finnish) | 0.00102 | 0.000976 |
Middle Eastern | 0.000654 | 0.000653 |
South Asian | 0.000498 | 0.000457 |
Other | 0.000859 | 0.000815 |
dbNSFP
Source:
- Function
- FUNCTION: Catalyzes the cleavage of L-kynurenine (L-Kyn) and L-3- hydroxykynurenine (L-3OHKyn) into anthranilic acid (AA) and 3- hydroxyanthranilic acid (3-OHAA), respectively. Has a preference for the L-3-hydroxy form. Also has cysteine-conjugate-beta-lyase activity. {ECO:0000269|PubMed:11985583, ECO:0000269|PubMed:17300176, ECO:0000269|PubMed:28792876, ECO:0000269|PubMed:8706755, ECO:0000269|PubMed:9180257}.;
- Disease
- DISEASE: Hydroxykynureninuria (HYXKY) [MIM:236800]: An inborn error of amino acid metabolism characterized by massive urinary excretion of large amounts of kynurenine, 3-hydroxykynurenine and xanthurenic acid. Affected individuals manifest renal tubular dysfunction, metabolic acidosis, psychomotor retardation, non- progressive encephalopathy, and muscular hypertonia. {ECO:0000269|PubMed:17334708, ECO:0000269|PubMed:28792876}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Vertebral, cardiac, renal, and limb defects syndrome 2 (VCRL2) [MIM:617661]: An autosomal recessive congenital malformation syndrome characterized by vertebral segmentation abnormalities, congenital cardiac defects, renal defects, and distal mild limb defects. {ECO:0000269|PubMed:28792876}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Tryptophan metabolism - Homo sapiens (human);Tryptophan Metabolism;Selenium Micronutrient Network;NAD Biosynthesis II (from tryptophan);Tryptophan metabolism;Tryptophan catabolism;Histidine, lysine, phenylalanine, tyrosine, proline and tryptophan catabolism;Metabolism of amino acids and derivatives;tryptophan degradation to 2-amino-3-carboxymuconate semialdehyde;Metabolism;L-kynurenine degradation;NAD <i>de novo</i> biosynthesis;Tryptophan degradation;superpathway of tryptophan utilization;tryptophan degradation
(Consensus)
Recessive Scores
- pRec
- 0.105
Intolerance Scores
- loftool
- 0.539
- rvis_EVS
- -0.6
- rvis_percentile_EVS
- 18.06
Haploinsufficiency Scores
- pHI
- 0.0582
- hipred
- N
- hipred_score
- 0.204
- ghis
- 0.537
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.876
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Kynu
- Phenotype
Gene ontology
- Biological process
- tryptophan catabolic process;aging;NAD biosynthetic process;tryptophan catabolic process to kynurenine;tryptophan catabolic process to acetyl-CoA;quinolinate biosynthetic process;response to interferon-gamma;'de novo' NAD biosynthetic process from tryptophan;response to vitamin B6;anthranilate metabolic process;L-kynurenine catabolic process
- Cellular component
- nucleoplasm;mitochondrion;cytosol
- Molecular function
- pyridoxal phosphate binding;kynureninase activity;protein homodimerization activity;3-hydroxykynureninase activity