KYNU

kynureninase

Basic information

Region (hg38): 2:142877657-143055833

Links

ENSG00000115919 ∙ NCBI:8942 ∙ OMIM:605197 ∙ HGNC:6469 ∙ Uniprot:Q16719 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• encephalopathy due to hydroxykynureninuria (Limited), mode of inheritance: AR
• encephalopathy due to hydroxykynureninuria (Supportive), mode of inheritance: AR
• congenital vertebral-cardiac-renal anomalies syndrome (Supportive), mode of inheritance: AR
• vertebral, cardiac, renal, and limb defects syndrome 2 (Limited), mode of inheritance: AR
• vertebral, cardiac, renal, and limb defects syndrome 2 (Strong), mode of inheritance: AR
• encephalopathy due to hydroxykynureninuria (Strong), mode of inheritance: AR
• vertebral, cardiac, renal, and limb defects syndrome 2 (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Vertebral, cardiac, renal, and limb defects syndrome 2	AR	Cardiovascular	The condition can involve congenital cardiac anomalies, and awareness may allow early identifcation and management	Biochemical; Cardiovascular; Musculoskeletal; Renal	17334708; 28792876; 34200361

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the KYNU gene.

• Vertebral, cardiac, renal, and limb defects syndrome 2 (3 variants)
• not provided (3 variants)
• Congenital NAD deficiency disorder (3 variants)
• Catel-Manzke syndrome (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the KYNU gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				4	3	7
missense	2	2	27	1	1	33
nonsense	1	2				3
start loss						0
frameshift	2	1				3
inframe indel						0
splice donor/acceptor (+/-2bp)	1	3				4
splice region			1	2	1	4
non coding				1	2	3
Total	6	8	27	6	6

Highest pathogenic variant AF is 0.0000526

Variants in KYNU

This is a list of pathogenic ClinVar variants found in the KYNU region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-142885361-A-T		KYNU-related disorder	Likely benign (Apr 02, 2024)
2-142885393-C-T		not specified	Uncertain significance (Apr 17, 2023)
2-142885411-G-A		not specified	Uncertain significance (Oct 25, 2023)
2-142885427-C-T		KYNU-related disorder	Likely benign (Dec 31, 2019)
2-142885441-C-T			Benign (Oct 01, 2022)
2-142885452-G-A		not specified	Uncertain significance (Feb 16, 2023)
2-142885488-C-T			Likely benign (Oct 02, 2018)
2-142885490-C-T			Benign (Dec 31, 2019)
2-142885494-A-G		not specified	Uncertain significance (Apr 08, 2022)
2-142885503-T-C		not specified	Uncertain significance (May 20, 2024)
2-142885509-A-T		not specified	Uncertain significance (Jan 31, 2022)
2-142918608-G-T		Vertebral, cardiac, renal, and limb defects syndrome 2 • Congenital NAD deficiency disorder	Pathogenic (Dec 23, 2016)
2-142918609-T-C		not specified	Uncertain significance (Oct 10, 2023)
2-142918634-T-C			Likely benign (Jul 02, 2018)
2-142918638-A-G		not specified	Uncertain significance (Apr 26, 2023)
2-142918694-A-AT		Vertebral, cardiac, renal, and limb defects syndrome 2	Pathogenic/Likely pathogenic (Aug 29, 2023)
2-142927652-A-G		not specified	Conflicting classifications of pathogenicity (Nov 07, 2023)
2-142927671-T-C			Likely benign (Nov 06, 2017)
2-142927694-G-C		Catel-Manzke syndrome	Pathogenic (Jan 07, 2012)
2-142927727-TGAA-T		Congenital NAD deficiency disorder • Vertebral, cardiac, renal, and limb defects syndrome 2	Pathogenic/Likely pathogenic (Mar 06, 2024)
2-142927737-TGTAG-T		KYNU-related disorder	Likely pathogenic (Jun 21, 2023)
2-142954375-CTTTTATAAAAGGTGTATTTTAATTTGATGTTAGAAACAACGAACTTTAAAAATGTAATTGGCCTTAATATCTTTTTAGATTCCTTTGAAGATATACTTAGCACAAAAATATGCTCCTTGGGAATTTGACAATTGAGCTGATAATAGGATATATCATTTTTAGTTTACAGGCAAAAGCAAATGCTTCATTATTTTGTTGTTATTTACTACATCATAAAAGAAATTTAATTTTAGCTAGCTGTGTGCATCTAAGTCCAGATATCATTTGATAAAATGAGTCAAGTGGGAAAACTTCCATTTCTTTGTGATGACACATCAAATATGCCCTTATCTCTAAAGACATTAAGAATGATTGAGTGAAGTCTTCCTACTTTGTTTTTTCAGTATCTTTAGACATAGTACAAACATCTAAATTACGATATGTTTATTTTACAGGAGCCAATGAGAAAGAAATAGCCCTAATGAATGCTTTGACTGTAAATTTACATCTTCTAATGGTAAGTTTTCTTTCCCACTAATGTTTAGAACACATTCATTTACAGAATCTGATGTTTTTCTATCTTTAATTCATGAGCTTCTGGGGGTTTACTTATTTAAAAATAAATTGTGAGGTTATTTTCATTTTTACTAGGAAATGCTGGACCATGATATAATAGCTTCTTCCTAATCATGGAAGAGTTGACTCTTGAGAAGAGCTTTAGAATAATGAACAGTTCTTGTCTGGGAAAATAAAGAATAAGAGCCATAATGGGTAAATAGGCAAACTACATGCAAGCCTACAAAACAGTGATGTACAATGCTAGCAAAGCACTGACCTTTTTGGAAAGACAATTTTCTAATGGCTTCAGCAGAGTGAGTTAGTGGA-C		Vertebral, cardiac, renal, and limb defects syndrome 2	Pathogenic (Mar 06, 2024)
2-142954808-A-G			not provided (-)
2-142956222-C-T		Vertebral, cardiac, renal, and limb defects syndrome 2 • not specified	Uncertain significance (Mar 02, 2023)
2-142956235-T-A		Vertebral, cardiac, renal, and limb defects syndrome 2 • Congenital NAD deficiency disorder	Pathogenic (Oct 11, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
KYNU	protein_coding	protein_coding	ENST00000264170	13	164824

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
4.18e-18	0.00552	125573	0	175	125748	0.000696

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.413	267	249	1.07	0.0000126	3032
Missense in Polyphen		93	95.641	0.97239		1068
Synonymous	0.829	79	88.9	0.888	0.00000456	878
Loss of Function	0.0902	27	27.5	0.981	0.00000151	333

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00116	0.00114
Ashkenazi Jewish	0.000332	0.000298
East Asian	0.000654	0.000653
Finnish	0.000382	0.000370
European (Non-Finnish)	0.00102	0.000976
Middle Eastern	0.000654	0.000653
South Asian	0.000498	0.000457
Other	0.000859	0.000815

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Catalyzes the cleavage of L-kynurenine (L-Kyn) and L-3- hydroxykynurenine (L-3OHKyn) into anthranilic acid (AA) and 3- hydroxyanthranilic acid (3-OHAA), respectively. Has a preference for the L-3-hydroxy form. Also has cysteine-conjugate-beta-lyase activity. {ECO:0000269|PubMed:11985583, ECO:0000269|PubMed:17300176, ECO:0000269|PubMed:28792876, ECO:0000269|PubMed:8706755, ECO:0000269|PubMed:9180257}.
• Disease: DISEASE: Hydroxykynureninuria (HYXKY) [MIM:236800]: An inborn error of amino acid metabolism characterized by massive urinary excretion of large amounts of kynurenine, 3-hydroxykynurenine and xanthurenic acid. Affected individuals manifest renal tubular dysfunction, metabolic acidosis, psychomotor retardation, non- progressive encephalopathy, and muscular hypertonia. {ECO:0000269|PubMed:17334708, ECO:0000269|PubMed:28792876}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Vertebral, cardiac, renal, and limb defects syndrome 2 (VCRL2) [MIM:617661]: An autosomal recessive congenital malformation syndrome characterized by vertebral segmentation abnormalities, congenital cardiac defects, renal defects, and distal mild limb defects. {ECO:0000269|PubMed:28792876}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Tryptophan metabolism - Homo sapiens (human);Tryptophan Metabolism;Selenium Micronutrient Network;NAD Biosynthesis II (from tryptophan);Tryptophan metabolism;Tryptophan catabolism;Histidine, lysine, phenylalanine, tyrosine, proline and tryptophan catabolism;Metabolism of amino acids and derivatives;tryptophan degradation to 2-amino-3-carboxymuconate semialdehyde;Metabolism;L-kynurenine degradation;NAD <i>de novo</i> biosynthesis;Tryptophan degradation;superpathway of tryptophan utilization;tryptophan degradation (Consensus)

Recessive Scores

• pRec: 0.105

Intolerance Scores

• loftool: 0.539
• rvis_EVS: -0.6
• rvis_percentile_EVS: 18.06

Haploinsufficiency Scores

• pHI: 0.0582
• hipred: N
• hipred_score: 0.204
• ghis: 0.537

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.876

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Kynu

Gene ontology

• Biological process: tryptophan catabolic process;aging;NAD biosynthetic process;tryptophan catabolic process to kynurenine;tryptophan catabolic process to acetyl-CoA;quinolinate biosynthetic process;response to interferon-gamma;'de novo' NAD biosynthetic process from tryptophan;response to vitamin B6;anthranilate metabolic process;L-kynurenine catabolic process
• Cellular component: nucleoplasm;mitochondrion;cytosol
• Molecular function: pyridoxal phosphate binding;kynureninase activity;protein homodimerization activity;3-hydroxykynureninase activity