MAGEC1

MAGE family member C1, the group of MAGE family

Basic information

Region (hg38): X:141903894-141909374

Links

ENSG00000155495 ∙ NCBI:9947 ∙ OMIM:300223 ∙ HGNC:6812 ∙ Uniprot:O60732 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MAGEC1 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MAGEC1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				7		7
missense			76	19	2	97
nonsense						0
start loss						0
frameshift				3		3
inframe indel				2		2
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	0	0	76	31	2

Variants in MAGEC1

This is a list of pathogenic ClinVar variants found in the MAGEC1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-141905074-T-C		Neutropenia;Lymphopenia	Likely benign (-)
X-141905522-A-T		not specified	Uncertain significance (Mar 07, 2024)
X-141905540-G-A		not specified	Uncertain significance (Jun 17, 2024)
X-141905565-C-T		not specified	Uncertain significance (Nov 20, 2023)
X-141905574-G-T		not specified	Uncertain significance (Dec 17, 2023)
X-141905607-A-G		not specified	Uncertain significance (Nov 10, 2022)
X-141905679-C-A		not specified	Uncertain significance (Mar 15, 2024)
X-141905682-A-G		not specified	Uncertain significance (Sep 01, 2021)
X-141905687-C-A		not specified	Uncertain significance (Aug 22, 2023)
X-141905802-G-A		not specified	Uncertain significance (Oct 12, 2022)
X-141905814-C-G			Likely benign (Feb 01, 2024)
X-141905831-A-C		not specified	Uncertain significance (Dec 14, 2023)
X-141905951-C-T		not specified	Uncertain significance (Jan 09, 2024)
X-141905973-T-C		not specified	Uncertain significance (Jun 21, 2022)
X-141906014-C-T		not specified	Uncertain significance (Oct 10, 2023)
X-141906015-GCTCCTTCTCCTCCACTTTATTGAGTATTTTCCAGAGTTCCCCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTCCTCTCCAGATTCCTGTGAGCCCCTCCTCCTCCTCCACTTTACTGAGTCTTTTCCAGAGTTTCTCTGAGAGAACTCAGAGTACTTTTGAGGGTTTTGCCCAGTCTTCTCTCCAGATTCCTGTGAGCCC-G			Likely benign (Mar 01, 2023)
X-141906021-T-C			Likely benign (Jul 01, 2023)
X-141906028-C-T			Likely benign (May 01, 2022)
X-141906033-T-C		not specified	Uncertain significance (Apr 11, 2023)
X-141906056-C-T			Likely benign (Feb 01, 2024)
X-141906091-C-A		not specified	Likely benign (Jun 21, 2023)
X-141906093-A-G		not specified	Uncertain significance (Dec 21, 2023)
X-141906098-C-G		not specified	Uncertain significance (Aug 10, 2021)
X-141906113-G-A		not specified	Uncertain significance (Sep 16, 2021)
X-141906119-C-G			Benign (Oct 01, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MAGEC1	protein_coding	protein_coding	ENST00000285879	2	5495

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0799	0.562	117661	1	0	117662	0.00000425

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-5.17	665	381	1.75	0.0000271	7415
Missense in Polyphen		9	9.775	0.92071		120
Synonymous	-4.50	222	152	1.46	0.0000114	2306
Loss of Function	-0.277	1	0.743	1.35	4.70e-8	12

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.0000127	0.00000929
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

Intolerance Scores

• loftool: 0.981
• rvis_EVS: 6.42
• rvis_percentile_EVS: 99.87

Haploinsufficiency Scores

• pHI: 0.0364

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.0486

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	High	Medium	High
Cancer	High	High	High

Gene ontology

• Molecular function: protein binding