MARS2

methionyl-tRNA synthetase 2, mitochondrial, the group of Aminoacyl tRNA synthetases, Class I

Basic information

Region (hg38): 2:197705369-197708395

Links

ENSG00000247626 ∙ NCBI:92935 ∙ OMIM:609728 ∙ HGNC:25133 ∙ Uniprot:Q96GW9 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• spastic ataxia 3 (Moderate), mode of inheritance: AR
• combined oxidative phosphorylation defect type 25 (Limited), mode of inheritance: AR
• spastic ataxia 3 (Supportive), mode of inheritance: AR
• combined oxidative phosphorylation defect type 25 (Supportive), mode of inheritance: AR
• combined oxidative phosphorylation defect type 25 (Limited), mode of inheritance: Unknown
• spastic ataxia 3 (Limited), mode of inheritance: AR
• mitochondrial disease (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Combined oxidative phosphorylation deficiency 25; Spastic ataxia 3, autosomal recessive	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Biochemical; Craniofacial; Neurologic	22448145; 25754315

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MARS2 gene.

• Combined oxidative phosphorylation defect type 25 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MARS2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			3	55	7	65
missense		1	107	5	2	115
nonsense			4			4
start loss		1	1			2
frameshift	1		4			5
inframe indel			1			1
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding				2	2	4
Total	1	2	120	62	11

Variants in MARS2

This is a list of pathogenic ClinVar variants found in the MARS2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-197705380-T-G			Benign (Mar 03, 2015)
2-197705403-A-G		MARS2-related disorder	Likely benign (Feb 19, 2019)
2-197705406-A-G		Spastic ataxia 3	Likely pathogenic (Mar 12, 2024)
2-197705405-C-CATGCTGCGAACGTCCGTCCTCCGCCTGCTAGGACGCACGGGGGCTAGTAGGCTGTCTCTCCTGGAGGACTTCGGCCCACGCTACTACAGTTCGGGCTCCCTCAGTGCCGGCGATGATGCTTGTGATGTGCGCGCCTACTTCACTACACCCATTTTCTACGTGAACGCGGCGCCGCACATCGGGCACCTGTACTCGGCACTACTGGCGGACGCCCTATGCCGCCACCGTCGCCTCCGAGGTCCCAGCACGGCCGCCACGCGATTCTCCACTGGTACCGACGAGCACGGGCTGAAGATTCAGCAGGCAGCAGCTACCGCGGGCCTGGCCCCGACCGAGCTGTGCGACCGAGTCTCTGAGCAGTTCCAGCAGCTTTTCCAGGAGGCCGGTATCTCCTGCACAGATTTCATCCGCACCACGGAGGCCCGGCACCGGGTGGCTGTGCAGCACTTCTGGGGGGTGCTTAAGTCCCGCGGTCTGCTCTACAAGGGCGTCTATGAAGGTTGGTATTGCGCTTCCGACGAGTGCTTCCTGCCTGAGGCCAAGGTCACCCAGCAGCCGGGCCCATCGGGGGATTCGTTTCCTGTATCTCTCGAGAGCGGGCATCCAGTCTCCTGGACCAAGGAAGAAAACTACATTTTCAGGCTTTCCCAGTTCCGGAAGCCACTCCAGCGGTGGCTGCGGGGCAACCCTCAGGCGATCACCCCCGAACCATTTCATCACGTAGTTCTTCAGTGGCTGGACGAGGAGCTGCCCGACCTGTCCGTGTCTCGCAGAAGTAGCCACTTGCACTGGGGCATTCCGGTGCCCGGGGATGATTCGCAGACCATCTATGTATGGCTGGATGCCCTGGTCAACTACCTCACTGTAATTGGCTACCCAAATGCTGAGTTCAAATCTTGGTGGCCGGCCACCTCTCATATCATAGGTAAGGACATTCTCAAATTCCATGCCATCTATTGGCCTGCCTTCCTGTTAGGGGCCGGCATGAGCCCGCCACAGCGCATCTGTGTCCATTCCCACTGGACAGTCTGTGGCCAAAAGATGTCCAAGAGCTTGGGCAACGTGGTGGATCCTAGGACTTGCCTTAACCGCTATACCGTGGATGGCTTCCGCTACTTTCTCCTTCGGCAGGGCGTCCCCAACTGGGACTGTGACTACTATGATGAAAAGGTGGTTAAGTTGCTGAACTCCGAGCTGGCAGATGCCTTGGGAGGTCTCTTGAACCGATGCACTGCCAAAAGAATAAATCCTTCTGAGACCTACCCAGCCTTCTGCACTACCTGCTTCCCTAGTGAGCCAGGGTTGGTGGGGCCGTCAGTTCGTGCTCAGGCAGAGGATTATGCTCTGGTGAGCGCAGTGGCCACTTTGCCAAAGCAGGTAGCAGACCACTATGATAACTTTCGGATATATAAGGCTCTGGAGGCCGTGTCCAGCTGTGTCCGGCAAACTAATGGTTTTGTCCAAAGGCATGCACCATGGAAGCTGAACTGGGAGAGCCCAGTGGATGCTCCCTGGCTGGGTACTGTGCTTCATGTGGCCTTGGAATGTTTGCGAGTCTTTGGGACTTTGCTGCAGCCTGTCACCCCAAGCCTAGCTGACAAGCTGCTGTCTAGGCTGGGGGTCTCTGCCTCAGAGAGGAGTCTTGGAGAGCTCTATTTCTTGCCTCGATTCTATGGACATCCATGCCCTTTTGAAGGGAGGAGGCTGGGACCTGAAACTGGGCTTTTGTTTCCAAGACTAGACCAGTCCAGGACTTGGCTGGTGAAAGCCCACCGGACCTAG		Spastic ataxia 3	Pathogenic (Jan 01, 2012)
2-197705408-G-C			Uncertain significance (Aug 24, 2022)
2-197705409-C-G			Uncertain significance (Nov 08, 2022)
2-197705410-T-G			Uncertain significance (Dec 19, 2023)
2-197705412-C-T			Uncertain significance (Nov 12, 2023)
2-197705414-A-G			Likely benign (Jan 18, 2024)
2-197705417-G-A		not specified	Benign (Jan 24, 2024)
2-197705418-T-A		not specified	Uncertain significance (Oct 25, 2024)
2-197705421-G-A			Uncertain significance (May 15, 2022)
2-197705427-C-A		not specified	Uncertain significance (Jan 23, 2024)
2-197705428-G-T			Uncertain significance (Aug 04, 2023)
2-197705429-C-G		not specified	Benign (Jan 24, 2024)
2-197705429-C-T			Likely benign (Mar 27, 2022)
2-197705431-T-A			Uncertain significance (Dec 11, 2023)
2-197705443-C-T			Uncertain significance (Mar 20, 2022)
2-197705448-G-A			Conflicting classifications of pathogenicity (Mar 27, 2024)
2-197705453-T-C		MARS2-related disorder	Likely benign (May 22, 2019)
2-197705457-C-T			Likely benign (Oct 07, 2021)
2-197705465-C-T		MARS2-related disorder	Benign/Likely benign (Nov 27, 2023)
2-197705466-C-G			Conflicting classifications of pathogenicity (Aug 01, 2024)
2-197705492-C-T			Likely benign (Dec 22, 2023)
2-197705493-A-T			Uncertain significance (Dec 27, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MARS2	protein_coding	protein_coding	ENST00000282276	1	3027

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0000545	0.973	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.299	316	331	0.954	0.0000163	3808
Missense in Polyphen		107	108.89	0.98265		1274
Synonymous	-1.02	160	144	1.11	0.00000703	1297
Loss of Function	1.99	10	19.5	0.514	9.54e-7	196

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Disease: DISEASE: Spastic ataxia 3, autosomal recessive (SPAX3) [MIM:611390]: A neurologic disorder characterized by cerebellar ataxia, ataxic gait, spasticity, and hyperreflexia. Other variable features include dysarthria, dysmetria, mild cognitive impairment, urinary urgency and dystonic positioning. {ECO:0000269|PubMed:22448145}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Combined oxidative phosphorylation deficiency 25 (COXPD25) [MIM:616430]: A mitochondrial disorder resulting in developmental delay, growth failure, and sensorineural hearing loss. {ECO:0000269|PubMed:25754315}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Selenocompound metabolism - Homo sapiens (human);Aminoacyl-tRNA biosynthesis - Homo sapiens (human);miR-targeted genes in lymphocytes - TarBase;Amino Acid metabolism;tRNA Aminoacylation;Translation;Metabolism of proteins;tRNA charging;Methionine and cysteine metabolism;Mitochondrial tRNA aminoacylation (Consensus)

Recessive Scores

• pRec: 0.193

Intolerance Scores

• loftool: 0.746
• rvis_EVS: -0.84
• rvis_percentile_EVS: 11.18

Haploinsufficiency Scores

• pHI: 0.0863
• hipred: Y
• hipred_score: 0.520
• ghis: 0.641

Essentials

• essential_gene_CRISPR: E
• essential_gene_CRISPR2: E
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.822

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Mars2

Gene ontology

• Biological process: tRNA aminoacylation for protein translation;methionyl-tRNA aminoacylation
• Cellular component: mitochondrion;mitochondrial matrix
• Molecular function: methionine-tRNA ligase activity;ATP binding