MCM3AP-AS1

MCM3AP antisense RNA 1, the group of Antisense RNAs

Basic information

Region (hg38): 21:46228394-46284359

Previous symbols: [ "C21orf85", "MCM3APAS", "MCM3AP-AS" ]

Links

ENSG00000215424 ∙ NCBI:114044 ∙ ∙ HGNC:16417 ∙ ∙ ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MCM3AP-AS1 gene.

• not provided (441 variants)
• Inborn genetic diseases (36 variants)
• Peripheral neuropathy, autosomal recessive, with or without impaired intellectual development (13 variants)
• MCM3AP-related condition (2 variants)
• not specified (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MCM3AP-AS1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense						0
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)			2	5	5	12
splice region						0
non coding	10	9	244	142	42	447
Total	10	9	246	147	47

Highest pathogenic variant AF is 0.0000197

Variants in MCM3AP-AS1

This is a list of pathogenic ClinVar variants found in the MCM3AP-AS1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
21-46228431-T-TA			Uncertain significance (Feb 18, 2022)
21-46228456-G-A		Inborn genetic diseases	Uncertain significance (Dec 14, 2022)
21-46228465-C-A		Inborn genetic diseases	Uncertain significance (Feb 23, 2023)
21-46228476-G-A			Likely benign (Dec 30, 2022)
21-46228522-C-T			Benign (Feb 01, 2024)
21-46228540-C-A			Uncertain significance (Feb 05, 2023)
21-46228559-C-T		Inborn genetic diseases	Uncertain significance (Aug 20, 2023)
21-46228577-G-A			Uncertain significance (May 27, 2022)
21-46228578-G-C			Likely benign (Oct 01, 2022)
21-46228579-C-T		Alopecia-intellectual disability syndrome 4	Pathogenic (Feb 10, 2022)
21-46228583-C-G		Inborn genetic diseases	Uncertain significance (May 03, 2023)
21-46228592-G-C		Alopecia-intellectual disability syndrome 4	Uncertain significance (Feb 05, 2022)
21-46228604-G-C		Inborn genetic diseases	Uncertain significance (May 09, 2022)
21-46228610-C-A			Likely benign (May 11, 2023)
21-46228611-C-G			Likely benign (Oct 17, 2022)
21-46228611-C-T			Benign (Jan 04, 2024)
21-46228612-G-C			Likely benign (Mar 09, 2022)
21-46228665-AGTCGCGCTCTCCTCAGCACCTAGGACCACCCCGCATTCGTCAGGAGCCCGGGGCGAGGGGACTCACGTGCCCTCCGTCATTGCTGCTGCAGTGCTCTACGCCGCCCACTGCCAGCTGCCAGATGTCCGCACCCGGGACCTGCCGCCCAGCCCCGCCCCTCCCGCCCCTCCCGCCCCTCCCGCCCCTCCCGCGCGCACTACGCAGGCGCAGGCCTCGGCAGGCGCTCAGGCTTAGGTGGGCCGACGCCCACGCAACCAATCAGAGCGCCGCGAGCGTGACCCCGGGGTGTGCCAGGCGACCACAGTGGTGGAGCGCTTGGTGCCCCATGCGGCGTGGGGC-A		Alopecia-intellectual disability syndrome 4	Pathogenic (-)
21-46228720-G-C			Likely benign (Jan 11, 2022)
21-46228743-C-G			Pathogenic (Nov 24, 2023)
21-46228755-A-T		LSS-related disorder	Likely benign (Jun 09, 2022)
21-46228813-A-C			Likely benign (Sep 13, 2019)
21-46228958-A-G			Benign (Jun 29, 2018)
21-46235113-A-C			Benign (May 13, 2021)
21-46235283-G-A			Likely benign (Sep 28, 2023)

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP

Haploinsufficiency Scores

• pHI: 0.103