MPV17

mitochondrial inner membrane protein MPV17

Basic information

Region (hg38): 2:27309492-27325680

Links

ENSG00000115204 ∙ NCBI:4358 ∙ OMIM:137960 ∙ HGNC:7224 ∙ Uniprot:P39210 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (Strong), mode of inheritance: AR
• mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (Supportive), mode of inheritance: AR
• Charcot-Marie-Tooth disease, axonal, type 2EE (Strong), mode of inheritance: AR
• mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (Strong), mode of inheritance: AR
• mitochondrial disease (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	AR	Biochemical; Gastrointestinal; Oncologic	Glycemic control (eg, with cornstarch) has been shown to slow the progression of hepatic disease; Liver transplanation has been described, though the efficacy is unclear; Awareness of the possible risk of hepatocellular carcinoma may be beneficial	Biochemical; Gastrointestinal; Musculoskeletal; Neurologic; Oncologic	16909392; 16582910; 18695062; 19520594; 19012992; 20074988; 21511859; 22508010; 22593919; 26437932; 30298599

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MPV17 gene.

• not provided (22 variants)
• Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (12 variants)
• Charcot-Marie-Tooth disease, axonal, type 2EE (7 variants)
• MPV17-related disorder (4 variants)
• Charcot-Marie-Tooth disease, axonal, type 2EE;Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) (4 variants)
• Mitochondrial DNA depletion syndrome (3 variants)
• Mitochondrial DNA depletion syndrome 15 (hepatocerebral type) (2 variants)
• Mitochondrial disease (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MPV17 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	63	1	66
missense	3	13	44	1		61
nonsense	7	13	1			21
start loss						0
frameshift	12	10	1			23
inframe indel		2	1			3
splice donor/acceptor (+/-2bp)	5	17				22
splice region		2	4	20		26
non coding		1	17	58	3	79
Total	27	56	66	122	4

Highest pathogenic variant AF is 0.0000789

Variants in MPV17

This is a list of pathogenic ClinVar variants found in the MPV17 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-27309499-T-G		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	Uncertain significance (Jan 12, 2018)
2-27309545-C-T		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309546-G-A		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309552-C-G		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	Uncertain significance (Jan 12, 2018)
2-27309561-G-A		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Mar 30, 2018)
2-27309565-G-A		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309683-A-G		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Likely benign (Jan 12, 2018)
2-27309718-C-T		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome	Uncertain significance (Jan 13, 2018)
2-27309724-T-C		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309782-C-A		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	Uncertain significance (Jan 12, 2018)
2-27309832-G-A		Mitochondrial DNA depletion syndrome • Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 12, 2018)
2-27309840-T-G		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309851-TCTGACCGTTCCAGGGTCAAGCTGCATCACTGCAAGGTGGAAACGATGGAGTGAGGCAGGCTTAGAGCCGATGTGCCTTCCAGGACAGGTAGGAGTTCCAGATAACAGCAACACATTGGACAACGGCCAACCTAAGGAACAGGAATAAC-T			Pathogenic (Nov 01, 2023)
2-27309858-G-A		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Uncertain significance (Jan 12, 2018)
2-27309878-C-T		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type) • Mitochondrial DNA depletion syndrome 15 (hepatocerebral type)	Uncertain significance (Jan 13, 2018)
2-27309900-A-C		Mitochondrial DNA depletion syndrome 6 (hepatocerebral type)	Conflicting classifications of pathogenicity (May 21, 2018)
2-27309901-G-C		not specified	Likely benign (Sep 08, 2016)
2-27309903-G-A		MPV17-related disorder	Likely benign (Sep 08, 2022)
2-27309915-G-A			Likely benign (Apr 25, 2022)
2-27309916-A-G			Uncertain significance (Sep 17, 2021)
2-27309919-C-G			Uncertain significance (Apr 14, 2023)
2-27309919-C-T		Inborn genetic diseases	Conflicting classifications of pathogenicity (Mar 01, 2024)
2-27309920-G-A		Inborn genetic diseases	Uncertain significance (Jun 22, 2023)
2-27309920-G-T			Likely benign (Jun 04, 2020)
2-27309924-T-C			Likely benign (Dec 24, 2020)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MPV17	protein_coding	protein_coding	ENST00000380044	7	16188

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
9.66e-11	0.0238	125699	0	49	125748	0.000195

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.237	89	95.5	0.932	0.00000537	1110
Missense in Polyphen		17	25.218	0.67413		316
Synonymous	0.262	36	38.1	0.946	0.00000195	363
Loss of Function	-0.646	14	11.6	1.20	5.13e-7	132

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00111	0.00110
Ashkenazi Jewish	0.000302	0.000298
East Asian	0.00	0.00
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.000167	0.000167
Middle Eastern	0.00	0.00
South Asian	0.000163	0.000163
Other	0.000331	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Involved in mitochondria homeostasis. May be involved in the metabolism of reactive oxygen species and control of oxidative phosphorylation and mitochondrial DNA (mtDNA) maintenance.
• Pathway: Peroxisome - Homo sapiens (human);Metabolism of proteins;Peroxisomal protein import (Consensus)

Intolerance Scores

• loftool: 0.402
• rvis_EVS: -0.27
• rvis_percentile_EVS: 33.97

Haploinsufficiency Scores

• pHI: 0.107
• hipred: N
• hipred_score: 0.325
• ghis: 0.581

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.261

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Mpv17
• Phenotype: endocrine/exocrine gland phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); pigmentation phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); hearing/vestibular/ear phenotype; skeleton phenotype; renal/urinary system phenotype

Zebrafish Information Network

• Gene name: mpv17
• Affected structure: iridophore
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: mitochondrial genome maintenance;protein targeting to peroxisome;glomerular basement membrane development;cellular response to reactive oxygen species;homeostatic process;inner ear development;regulation of reactive oxygen species metabolic process
• Cellular component: cytoplasm;mitochondrion;mitochondrial inner membrane;peroxisome;peroxisomal membrane;cytosol;integral component of membrane
• Molecular function: molecular_function