MRNIP
Basic information
Region (hg38): 5:179835133-179862173
Previous symbols: [ "C5orf45" ]
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
- Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset (3 variants)
- SQSTM1-related disorder (1 variants)
- Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the MRNIP gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 3 | |||||
missense | 5 | |||||
nonsense | 4 | |||||
start loss | 0 | |||||
frameshift | 0 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region | 1 | 1 | ||||
non coding | 59 | 32 | 99 | |||
Total | 4 | 2 | 65 | 37 | 3 |
Highest pathogenic variant AF is 0.0000131
Variants in MRNIP
This is a list of pathogenic ClinVar variants found in the MRNIP region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
5-179836413-T-C | SQSTM1-related disorder | Likely benign (Feb 26, 2024) | ||
5-179836416-C-T | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 | Likely benign (Nov 08, 2023) | ||
5-179836419-CCTTA-C | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Inborn genetic diseases • SQSTM1-related disorder | Benign/Likely benign (Jan 27, 2025) | ||
5-179836424-C-T | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Likely benign (Jun 12, 2024) | ||
5-179836430-C-T | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • SQSTM1-related disorder | Likely benign (May 23, 2024) | ||
5-179836431-G-A | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Paget disease of bone 3 | Uncertain significance (Jan 30, 2025) | ||
5-179836434-A-G | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Conflicting classifications of pathogenicity (Feb 05, 2024) | ||
5-179836435-G-A | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 | Uncertain significance (Dec 03, 2024) | ||
5-179836438-G-A | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Uncertain significance (Aug 26, 2021) | ||
5-179836439-CT-C | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Pathogenic/Likely pathogenic (Apr 01, 2023) | ||
5-179836440-T-C | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Likely benign (Jul 23, 2024) | ||
5-179836441-G-A | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 | Uncertain significance (Jul 17, 2023) | ||
5-179836442-A-G | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Uncertain significance (Dec 22, 2024) | ||
5-179836442-AC-A | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Pathogenic (Apr 11, 2022) | ||
5-179836445-C-T | Paget disease of bone 3 • Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 • Paget disease of bone 3;Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 • Spastic paraplegia-Paget disease of bone syndrome • Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Amyotrophic lateral sclerosis • Bone Paget disease | Conflicting classifications of pathogenicity (Apr 30, 2025) | ||
5-179836446-G-A | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 • not specified • Paget disease of bone 3 • Paget disease of bone 3;Myopathy, distal, with rimmed vacuoles;Frontotemporal dementia and/or amyotrophic lateral sclerosis 3;Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset | Benign/Likely benign (Jan 14, 2025) | ||
5-179836447-C-T | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • SQSTM1-related disorder | Uncertain significance (Oct 31, 2024) | ||
5-179836448-G-A | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 • SQSTM1-related disorder | Uncertain significance (Aug 28, 2024) | ||
5-179836447-CGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTGTGACCACTTTTGCCCACCTCTTCTGCGTGCCCCTCTTCTGTCTCATAGTTGTGTTAAGCTTGCGTAGAATTGCAGGTCTCTGTACGGGCCAGTTTCTCTGCCTTCTTCCAGGATCAGGGGTTAGGGTGCAAGAAGCCATTTAGGGCAGCAAAACAAGTGACATGAAGGGAGGGTCCCTGTGTGTGTGTGTGCTGATGTTTCCTGGGTGCCCTGGCTCCTTGCAGCAGGGCTGGGCCTGCGAGACCCAAGGCTCACTGCAGCGCGCTCCTGACCCCTCCCTGCAGGGGCTACGTTAGCAGCCCAGCACATAGCTTGCCTAATGGCTTTCACTTTCTCTTTTGTTTTAAATGACTCATAGGTCCCTGACATTTAGTTGATTATTTTCTGCTACAGACCTGGTACACTCTGATTTTAGATAAAGTAAGCCTAGGTGTTGTCAGCAGGCAGGCTGGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGAGCTGCCTCCTGGTCTCTTCACCACTGTAGTTCTCTCATTTCCAAACCATCAGCTGCTTTTAAAATAAGATCTCTTTGTAGCCATCCTGTTAAATTTGTAAACAATCTAATTAAAT-C | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 | Likely pathogenic (Dec 07, 2023) | ||
5-179836453-A-AT | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Pathogenic (Jun 11, 2024) | ||
5-179836454-T-C | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Uncertain significance (Sep 21, 2021) | ||
5-179836458-G-A | Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 | Likely benign (Dec 23, 2024) | ||
5-179836460-C-A | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Uncertain significance (Oct 18, 2022) | ||
5-179836464-C-T | Uncertain significance (May 25, 2024) | |||
5-179836468-C-A | Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset | Uncertain significance (Jul 19, 2022) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
MRNIP | protein_coding | protein_coding | ENST00000292586 | 7 | 27738 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.0000134 | 0.639 | 124952 | 3 | 793 | 125748 | 0.00317 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | -0.273 | 198 | 187 | 1.06 | 0.0000102 | 2182 |
Missense in Polyphen | 53 | 47.88 | 1.1069 | 674 | ||
Synonymous | -2.54 | 104 | 75.9 | 1.37 | 0.00000442 | 682 |
Loss of Function | 0.902 | 9 | 12.4 | 0.724 | 5.28e-7 | 151 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00854 | 0.00849 |
Ashkenazi Jewish | 0.00347 | 0.00348 |
East Asian | 0.000381 | 0.000381 |
Finnish | 0.000707 | 0.000693 |
European (Non-Finnish) | 0.00366 | 0.00365 |
Middle Eastern | 0.000381 | 0.000381 |
South Asian | 0.00353 | 0.00353 |
Other | 0.00505 | 0.00506 |
dbNSFP
Source:
- Function
- FUNCTION: Plays a role in the cellular response to DNA damage and the maintenance of genome stability through its association with the MRN damage-sensing complex (PubMed:27568553). Promotes chromatin loading and activity of the MRN complex to facilitate subsequent ATM-mediated DNA damage response signaling and DNA repair (PubMed:27568553).;
Intolerance Scores
- loftool
- rvis_EVS
- 1.11
- rvis_percentile_EVS
- 92.04
Haploinsufficiency Scores
- pHI
- hipred
- N
- hipred_score
- 0.123
- ghis
- 0.402
Essentials
- essential_gene_CRISPR
- essential_gene_CRISPR2
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- gene_indispensability_score
Mouse Genome Informatics
- Gene name
- Mrnip
- Phenotype
- behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan);
Gene ontology
- Biological process
- DNA repair;cellular response to DNA damage stimulus;mitotic G2 DNA damage checkpoint;response to ionizing radiation;positive regulation of protein kinase activity;protein localization to chromatin;positive regulation of double-strand break repair via homologous recombination;regulation of double-strand break repair via nonhomologous end joining
- Cellular component
- nucleus;nucleoplasm;Mre11 complex
- Molecular function
- chromatin binding;protein binding