MRNIP

MRN complex interacting protein

Basic information

Region (hg38): 5:179835133-179862173

Previous symbols: [ "C5orf45" ]

Links

ENSG00000161010 ∙ NCBI:51149 ∙ OMIM:617154 ∙ HGNC:30817 ∙ Uniprot:Q6NTE8 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MRNIP gene.

• Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset (3 variants)
• SQSTM1-related disorder (1 variants)
• Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MRNIP gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				3		3
missense			4		1	5
nonsense			2	2		4
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region		1				1
non coding	4	2	59	32	2	99
Total	4	2	65	37	3

Highest pathogenic variant AF is 0.0000131

Variants in MRNIP

This is a list of pathogenic ClinVar variants found in the MRNIP region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
5-179836413-T-C		SQSTM1-related disorder	Likely benign (Feb 26, 2024)
5-179836416-C-T		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Likely benign (Nov 08, 2023)
5-179836419-CCTTA-C		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Inborn genetic diseases • SQSTM1-related disorder	Benign/Likely benign (Jan 27, 2025)
5-179836424-C-T		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Likely benign (Jun 12, 2024)
5-179836430-C-T		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 • SQSTM1-related disorder	Likely benign (May 23, 2024)
5-179836431-G-A		Paget disease of bone 3 • Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Uncertain significance (Jan 30, 2025)
5-179836434-A-G		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Conflicting classifications of pathogenicity (Feb 05, 2024)
5-179836435-G-A		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Uncertain significance (Dec 03, 2024)
5-179836438-G-A		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Uncertain significance (Aug 26, 2021)
5-179836439-CT-C		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Pathogenic/Likely pathogenic (Apr 01, 2023)
5-179836440-T-C		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Likely benign (Jul 23, 2024)
5-179836441-G-A		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Uncertain significance (Jul 17, 2023)
5-179836442-A-G		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Uncertain significance (Dec 22, 2024)
5-179836442-AC-A		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Pathogenic (Apr 11, 2022)
5-179836445-C-T		Paget disease of bone 3 • Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 • Amyotrophic lateral sclerosis • Paget disease of bone 3;Frontotemporal dementia and/or amyotrophic lateral sclerosis 3 • Spastic paraplegia-Paget disease of bone syndrome • Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Bone Paget disease	Conflicting classifications of pathogenicity (Feb 01, 2025)
5-179836446-G-A		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • Paget disease of bone 3 • not specified • Frontotemporal dementia and/or amyotrophic lateral sclerosis 3;Neurodegeneration with ataxia, dystonia, and gaze palsy, childhood-onset;Myopathy, distal, with rimmed vacuoles;Paget disease of bone 3	Benign/Likely benign (Jan 14, 2025)
5-179836447-C-T		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1 • SQSTM1-related disorder	Uncertain significance (Oct 31, 2024)
5-179836448-G-A		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset • SQSTM1-related disorder	Uncertain significance (Aug 28, 2024)
5-179836447-CGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTGTGACCACTTTTGCCCACCTCTTCTGCGTGCCCCTCTTCTGTCTCATAGTTGTGTTAAGCTTGCGTAGAATTGCAGGTCTCTGTACGGGCCAGTTTCTCTGCCTTCTTCCAGGATCAGGGGTTAGGGTGCAAGAAGCCATTTAGGGCAGCAAAACAAGTGACATGAAGGGAGGGTCCCTGTGTGTGTGTGTGCTGATGTTTCCTGGGTGCCCTGGCTCCTTGCAGCAGGGCTGGGCCTGCGAGACCCAAGGCTCACTGCAGCGCGCTCCTGACCCCTCCCTGCAGGGGCTACGTTAGCAGCCCAGCACATAGCTTGCCTAATGGCTTTCACTTTCTCTTTTGTTTTAAATGACTCATAGGTCCCTGACATTTAGTTGATTATTTTCTGCTACAGACCTGGTACACTCTGATTTTAGATAAAGTAAGCCTAGGTGTTGTCAGCAGGCAGGCTGGGGAGGCCAGTGTTGTGGGCTTCCTGCTGGGACTGAGAAGGCTCACGAAGGGCATCCGCAATGTTGGTTTCACTGAGAGCTGCCTCCTGGTCTCTTCACCACTGTAGTTCTCTCATTTCCAAACCATCAGCTGCTTTTAAAATAAGATCTCTTTGTAGCCATCCTGTTAAATTTGTAAACAATCTAATTAAAT-C		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Likely pathogenic (Dec 07, 2023)
5-179836453-A-AT		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Pathogenic (Jun 11, 2024)
5-179836454-T-C		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Uncertain significance (Sep 21, 2021)
5-179836458-G-A		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Likely benign (Dec 23, 2024)
5-179836460-C-A		Paget disease of bone 2, early-onset;Frontotemporal dementia and/or amyotrophic lateral sclerosis 1	Uncertain significance (Oct 18, 2022)
5-179836464-C-T			Uncertain significance (May 25, 2024)
5-179836468-C-A		Frontotemporal dementia and/or amyotrophic lateral sclerosis 1;Paget disease of bone 2, early-onset	Uncertain significance (Jul 19, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MRNIP	protein_coding	protein_coding	ENST00000292586	7	27738

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0000134	0.639	124952	3	793	125748	0.00317

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.273	198	187	1.06	0.0000102	2182
Missense in Polyphen		53	47.88	1.1069		674
Synonymous	-2.54	104	75.9	1.37	0.00000442	682
Loss of Function	0.902	9	12.4	0.724	5.28e-7	151

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00854	0.00849
Ashkenazi Jewish	0.00347	0.00348
East Asian	0.000381	0.000381
Finnish	0.000707	0.000693
European (Non-Finnish)	0.00366	0.00365
Middle Eastern	0.000381	0.000381
South Asian	0.00353	0.00353
Other	0.00505	0.00506

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Plays a role in the cellular response to DNA damage and the maintenance of genome stability through its association with the MRN damage-sensing complex (PubMed:27568553). Promotes chromatin loading and activity of the MRN complex to facilitate subsequent ATM-mediated DNA damage response signaling and DNA repair (PubMed:27568553).

Intolerance Scores

• rvis_EVS: 1.11
• rvis_percentile_EVS: 92.04

Haploinsufficiency Scores

• hipred: N
• hipred_score: 0.123
• ghis: 0.402

Essentials

• essential_gene_gene_trap: N

Mouse Genome Informatics

• Gene name: Mrnip
• Phenotype: behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Gene ontology

• Biological process: DNA repair;cellular response to DNA damage stimulus;mitotic G2 DNA damage checkpoint;response to ionizing radiation;positive regulation of protein kinase activity;protein localization to chromatin;positive regulation of double-strand break repair via homologous recombination;regulation of double-strand break repair via nonhomologous end joining
• Cellular component: nucleus;nucleoplasm;Mre11 complex
• Molecular function: chromatin binding;protein binding