MT-CO1

mitochondrially encoded cytochrome c oxidase I, the group of Mitochondrial complex IV: cytochrome c oxidase subunits|Mitochondrially encoded protein coding genes

Basic information

Region (hg38): M:5904-7445

Previous symbols: [ "MTCO1" ]

Links

ENSG00000198804 ∙ NCBI:4512 ∙ OMIM:516030 ∙ HGNC:7419 ∙ Uniprot:P00395 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

  • MELAS syndrome (Supportive), mode of inheritance: Mitochondrial
  • mitochondrial non-syndromic sensorineural hearing loss (Supportive), mode of inheritance: Mitochondrial
  • hereditary recurrent myoglobinuria (Supportive), mode of inheritance: AD
  • cytochrome-c oxidase deficiency disease (Supportive), mode of inheritance: AR
  • Leigh syndrome (Limited), mode of inheritance: Mitochondrial
  • mitochondrial disease (Definitive), mode of inheritance: Mitochondrial

Clinical Genomic Database

Source: CGD

ConditionInheritanceIntervention CategoriesIntervention/Rationale Manifestation CategoriesReferences
Deafness, mitochondrialMaternalAudiologic/Otolaryngologic; PharmacogenomicMitochondrial variants may involve a variety of sequelae, including hearing impairment, with highly variable age of onset, and for individuals with early-onset hearing impairment, early recognition and treatment of hearing impairment may improve outcomes, including speech and language development; Aminoglycosides should be avoidedAudiologic/Otolaryngologic; Biochemical; Hematologic; Musculoskeletal; Neurologic; Ophthalmologic; Renal1634041; 10577941; 10980727; 12140182
In some individuals, aminoglycoside administration can result in deafness; Cosegregation with other variants may result in disease

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MT-CO1 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MT-CO1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type Pathogenic Likely pathogenic VUS Likely benign Benign Sum
synonymous
0
missense
0
nonsense
0
start loss
0
frameshift
0
inframe indel
0
splice donor/acceptor (+/-2bp)
0
splice region
0
non coding
0
Total 0 0 0 0 0

Variants in MT-CO1

This is a list of pathogenic ClinVar variants found in the MT-CO1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position Type Phenotype Significance ClinVar
M-5907-T-C Leigh syndrome Uncertain significance (Oct 17, 2019)692598
M-5910-G-A Leigh syndrome Benign (Oct 17, 2019)692599
M-5911-C-T Leigh syndrome Benign (Oct 17, 2019)692600
M-5913-G-A Leigh syndrome • not specified Benign (Jul 27, 2020)692601
M-5918-T-C Benign (Jul 12, 2019)805023
M-5920-G-A Myoglobinuria, recurrent • Mitochondrial disease Likely pathogenic (Jan 22, 2024)9669
M-5951-A-G Benign/Likely benign (May 25, 2018)235783
M-5953-CA-C Tetralogy of Fallot Pathogenic (-)590893
M-5961-C-A Leigh syndrome Uncertain significance (Oct 17, 2019)692602
M-5973-G-A Leigh syndrome Benign (Oct 17, 2019)692603
M-5979-G-A Leigh syndrome Benign (Oct 17, 2019)692604
M-5985-G-A Leigh syndrome Benign (Oct 17, 2019)692605
M-5996-A-G not specified Benign (Feb 16, 2025)3911626
M-5999-T-C not specified Benign (Feb 16, 2025)994642
M-6002-AAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCCATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTCTACCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCATAATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAACTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGAACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCCGCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATCAACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATAACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTTATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTATCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGCTCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATCCCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTACTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTAAGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTTTTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAATTAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCCTAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAATAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCTATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCATCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCTCAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATCACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTTCTGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAATAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCAACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCCGCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAGAAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTACAAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTAGCATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTACTATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACACCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAGCAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTACATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACTGACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGAACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCCT-A Mitochondrial disease Pathogenic (May 22, 2017)430674
M-6012-A-G Leigh syndrome Uncertain significance (Oct 17, 2019)692606
M-6018-G-A Leigh syndrome Benign (Oct 17, 2019)692607
M-6026-G-A Benign (Nov 16, 2018)805024
M-6037-G-A Leigh syndrome Uncertain significance (Oct 17, 2019)692608
M-6040-A-G Leigh syndrome Benign (Oct 17, 2019)692609
M-6045-C-T not specified Likely benign (Feb 16, 2025)3911627
M-6047-A-G not specified Benign (Feb 16, 2025)994643
M-6048-G-A Leigh syndrome Uncertain significance (Oct 17, 2019)692610
M-6052-A-G Leigh syndrome Likely benign (Oct 17, 2019)692611
M-6054-G-A Uncertain significance (Mar 05, 2018)618721

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP

Function
FUNCTION: Cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Subunits 1- 3 form the functional core of the enzyme complex. CO I is the catalytic subunit of the enzyme. Electrons originating in cytochrome c are transferred via the copper A center of subunit 2 and heme A of subunit 1 to the bimetallic center formed by heme A3 and copper B.;
Disease
DISEASE: Leber hereditary optic neuropathy (LHON) [MIM:535000]: A maternally inherited disease resulting in acute or subacute loss of central vision, due to optic nerve dysfunction. Cardiac conduction defects and neurological defects have also been described in some patients. LHON results from primary mitochondrial DNA mutations affecting the respiratory chain complexes. {ECO:0000269|PubMed:1322638}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=MT-CO1 may play a role in the pathogenesis of acquired idiopathic sideroblastic anemia, a disease characterized by inadequate formation of heme and excessive accumulation of iron in mitochondria. Mitochondrial iron overload may be attributable to mutations of mitochondrial DNA because these can cause respiratory chain dysfunction, thereby impairing reduction of ferric iron to ferrous iron. The reduced form of iron is essential to the last step of mitochondrial heme biosynthesis. {ECO:0000269|PubMed:9389715, ECO:0000269|PubMed:9851701}.; DISEASE: Mitochondrial complex IV deficiency (MT-C4D) [MIM:220110]: A disorder of the mitochondrial respiratory chain with heterogeneous clinical manifestations, ranging from isolated myopathy to severe multisystem disease affecting several tissues and organs. Features include hypertrophic cardiomyopathy, hepatomegaly and liver dysfunction, hypotonia, muscle weakness, exercise intolerance, developmental delay, delayed motor development and mental retardation. Some affected individuals manifest a fatal hypertrophic cardiomyopathy resulting in neonatal death. A subset of patients manifest Leigh syndrome. {ECO:0000269|PubMed:12140182, ECO:0000269|PubMed:16284789}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Recurrent myoglobinuria mitochondrial (RM-MT) [MIM:550500]: Recurrent myoglobinuria is characterized by recurrent attacks of rhabdomyolysis (necrosis or disintegration of skeletal muscle) associated with muscle pain and weakness, and followed by excretion of myoglobin in the urine. {ECO:0000269|PubMed:10980727}. Note=The gene represented in this entry may be involved in disease pathogenesis.; DISEASE: Deafness, sensorineural, mitochondrial (DFNM) [MIM:500008]: A form of non-syndromic deafness with maternal inheritance. Affected individuals manifest progressive, postlingual, sensorineural hearing loss involving high frequencies. {ECO:0000269|PubMed:10577941}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Colorectal cancer (CRC) [MIM:114500]: A complex disease characterized by malignant lesions arising from the inner wall of the large intestine (the colon) and the rectum. Genetic alterations are often associated with progression from premalignant lesion (adenoma) to invasive adenocarcinoma. Risk factors for cancer of the colon and rectum include colon polyps, long-standing ulcerative colitis, and genetic family history. {ECO:0000269|PubMed:16407113, ECO:0000269|PubMed:19218458}. Note=The gene represented in this entry may be involved in disease pathogenesis.;
Pathway
Cardiac muscle contraction - Homo sapiens (human);Non-alcoholic fatty liver disease (NAFLD) - Homo sapiens (human);Alzheimer,s disease - Homo sapiens (human);Huntington,s disease - Homo sapiens (human);Thermogenesis - Homo sapiens (human);Oxidative phosphorylation - Homo sapiens (human);Parkinson,s disease - Homo sapiens (human);Electron Transport Chain;Effects of Nitric Oxide;Quercetin and Nf-kB- AP-1 Induced Cell Apoptosis;Gene expression (Transcription);Generic Transcription Pathway;RNA Polymerase II Transcription;Respiratory electron transport;The citric acid (TCA) cycle and respiratory electron transport;Metabolism;TP53 Regulates Metabolic Genes;Transcriptional Regulation by TP53;Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins. (Consensus)

Haploinsufficiency Scores

pHI
0.150
hipred
hipred_score
ghis
0.435

Essentials

essential_gene_CRISPR
essential_gene_CRISPR2
essential_gene_gene_trap
gene_indispensability_pred
E
gene_indispensability_score
0.539

Mouse Genome Informatics

Gene name
mt-Co1
Phenotype
muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); growth/size/body region phenotype; immune system phenotype;

Gene ontology

Biological process
mitochondrial electron transport, cytochrome c to oxygen;response to oxidative stress;aging;aerobic respiration;electron transport coupled proton transport;cerebellum development;response to copper ion;response to electrical stimulus
Cellular component
mitochondrial inner membrane;mitochondrial respiratory chain complex III;mitochondrial respiratory chain complex IV;integral component of membrane;respiratory chain complex IV
Molecular function
cytochrome-c oxidase activity;protein binding;heme binding;metal ion binding