MUC3A

mucin 3A, cell surface associated, the group of Mucins

Basic information

Region (hg38): 7:100949534-100968347

Previous symbols: [ "MUC3" ]

Links

ENSG00000169894 ∙ NCBI:4584 ∙ OMIM:158371 ∙ HGNC:7513 ∙ Uniprot:Q02505 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MUC3A gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MUC3A gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				19		19
missense				1		1
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding				1		1
Total	0	0	0	21	0

Variants in MUC3A

This is a list of pathogenic ClinVar variants found in the MUC3A region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
7-100952346-TCCCTCTACCACCACTGCAAGGGAA-T		Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
7-100952358-CACTGCAAGGGAAACTCCCATAGTGACAGTG-C		Lung cancer	Pathogenic (Jun 15, 2021)
7-100952374-CCCATAGTGACAGTGACACCCTCCTCTGTGTCAGCCACAGACACAACCTTCCACACTACAATCTCGTCTACAACTAGAACCACAGAAAGGACTCCCCTGCCCACTGGAAGCATCCATACAACCACGTCCCCAACCCCAGTATTTACTACTCTCAAAACAGCAGTGACTTCCACTT-C		Lung cancer • Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
7-100952401-GTGTCAGCCAC-G		Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
7-100952415-CACAACCT-C		Lung cancer • Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
7-100952427-CACTACAATCTCGTCTACAACTAGAACCACAGAA-C		Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
7-100952649-GA-G		Small cell lung carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
7-100952650-AC-A		Small cell lung carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
7-100952683-G-GAAGTAGTCACCAGTGGCACCAT		Lung cancer	Pathogenic (Jun 15, 2021)
7-100952727-C-A			Likely benign (Aug 01, 2023)
7-100952733-G-A			Likely benign (Nov 01, 2023)
7-100952816-A-AGT		Lung cancer	Pathogenic (Jun 15, 2021)
7-100952833-GCC-G		Lung cancer	Pathogenic (Jun 15, 2021)
7-100952867-CAGA-C		Lung cancer	Pathogenic (Jun 15, 2021)
7-100952874-T-C			Likely benign (Aug 01, 2023)
7-100952904-A-C			Likely benign (Aug 01, 2023)
7-100952967-C-A			Likely benign (Aug 01, 2023)
7-100953392-C-G		Lung cancer	Pathogenic (Jun 15, 2021)
7-100958568-T-T			Likely benign (Aug 01, 2023)
7-100958760-G-A			Likely benign (Aug 01, 2023)
7-100958787-C-T			Likely benign (Aug 01, 2023)
7-100958910-T-C			Likely benign (Sep 01, 2023)
7-100958913-A-G			Likely benign (Aug 01, 2023)
7-100958925-T-C			Likely benign (Aug 01, 2023)
7-100959000-T-C			Likely benign (Aug 01, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MUC3A	protein_coding	protein_coding	ENST00000319509	11	63932

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.48e-10	0.576	117536	0	28	117564	0.000119

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.601	447	413	1.08	0.0000194	5188
Missense in Polyphen		92	106.69	0.86232		1449
Synonymous	0.0581	163	164	0.994	0.00000851	1766
Loss of Function	1.32	19	26.3	0.723	0.00000129	311

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000591	0.0000591
Ashkenazi Jewish	0.000102	0.000100
East Asian	0.000388	0.000384
Finnish	0.00	0.00
European (Non-Finnish)	0.0000472	0.0000459
Middle Eastern	0.000388	0.000384
South Asian	0.000432	0.000428
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Major glycoprotein component of a variety of mucus gels. Thought to provide a protective, lubricating barrier against particles and infectious agents at mucosal surfaces. May be involved in ligand binding and intracellular signaling. {ECO:0000269|PubMed:10405327}.
• Pathway: Post-translational protein modification;Dectin-2 family;Metabolism of proteins;C-type lectin receptors (CLRs);Innate Immune System;Immune System;Termination of O-glycan biosynthesis;O-linked glycosylation of mucins;O-linked glycosylation (Consensus)

Haploinsufficiency Scores

• ghis: 0.472

Essentials

• gene_indispensability_pred: N
• gene_indispensability_score: 0.259

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	High	Medium	High
Primary Immunodeficiency	High	High	High
Cancer	High	High	High

Mouse Genome Informatics

• Gene name: Muc3a

Gene ontology

• Biological process: stimulatory C-type lectin receptor signaling pathway;O-glycan processing
• Cellular component: extracellular region;Golgi lumen;plasma membrane;integral component of membrane
• Molecular function: extracellular matrix structural constituent;extracellular matrix constituent, lubricant activity