MUC3A
Basic information
Region (hg38): 7:100949534-100968347
Previous symbols: [ "MUC3" ]
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the MUC3A gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 19 | 19 | ||||
missense | 1 | |||||
nonsense | 0 | |||||
start loss | 0 | |||||
frameshift | 0 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region | 0 | |||||
non coding | 1 | |||||
Total | 0 | 0 | 0 | 21 | 0 |
Variants in MUC3A
This is a list of pathogenic ClinVar variants found in the MUC3A region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
7-100952346-TCCCTCTACCACCACTGCAAGGGAA-T | Small cell lung carcinoma | Pathogenic (Jun 15, 2021) | ||
7-100952358-CACTGCAAGGGAAACTCCCATAGTGACAGTG-C | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952374-CCCATAGTGACAGTGACACCCTCCTCTGTGTCAGCCACAGACACAACCTTCCACACTACAATCTCGTCTACAACTAGAACCACAGAAAGGACTCCCCTGCCCACTGGAAGCATCCATACAACCACGTCCCCAACCCCAGTATTTACTACTCTCAAAACAGCAGTGACTTCCACTT-C | Lung cancer • Small cell lung carcinoma | Pathogenic (Jun 15, 2021) | ||
7-100952401-GTGTCAGCCAC-G | Small cell lung carcinoma | Pathogenic (Jun 15, 2021) | ||
7-100952415-CACAACCT-C | Lung cancer • Small cell lung carcinoma | Pathogenic (Jun 15, 2021) | ||
7-100952427-CACTACAATCTCGTCTACAACTAGAACCACAGAA-C | Small cell lung carcinoma | Pathogenic (Jun 15, 2021) | ||
7-100952649-GA-G | Small cell lung carcinoma • Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952650-AC-A | Small cell lung carcinoma • Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952683-G-GAAGTAGTCACCAGTGGCACCAT | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952727-C-A | Likely benign (Aug 01, 2023) | |||
7-100952733-G-A | Likely benign (Nov 01, 2023) | |||
7-100952816-A-AGT | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952833-GCC-G | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952867-CAGA-C | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100952874-T-C | Likely benign (Aug 01, 2023) | |||
7-100952904-A-C | Likely benign (Aug 01, 2023) | |||
7-100952967-C-A | Likely benign (Aug 01, 2023) | |||
7-100953392-C-G | Lung cancer | Pathogenic (Jun 15, 2021) | ||
7-100958568-T-T | Likely benign (Aug 01, 2023) | |||
7-100958760-G-A | Likely benign (Aug 01, 2023) | |||
7-100958787-C-T | Likely benign (Aug 01, 2023) | |||
7-100958910-T-C | Likely benign (Sep 01, 2023) | |||
7-100958913-A-G | Likely benign (Aug 01, 2023) | |||
7-100958925-T-C | Likely benign (Aug 01, 2023) | |||
7-100959000-T-C | Likely benign (Aug 01, 2023) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
MUC3A | protein_coding | protein_coding | ENST00000319509 | 11 | 63932 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
1.48e-10 | 0.576 | 117536 | 0 | 28 | 117564 | 0.000119 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | -0.601 | 447 | 413 | 1.08 | 0.0000194 | 5188 |
Missense in Polyphen | 92 | 106.69 | 0.86232 | 1449 | ||
Synonymous | 0.0581 | 163 | 164 | 0.994 | 0.00000851 | 1766 |
Loss of Function | 1.32 | 19 | 26.3 | 0.723 | 0.00000129 | 311 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.0000591 | 0.0000591 |
Ashkenazi Jewish | 0.000102 | 0.000100 |
East Asian | 0.000388 | 0.000384 |
Finnish | 0.00 | 0.00 |
European (Non-Finnish) | 0.0000472 | 0.0000459 |
Middle Eastern | 0.000388 | 0.000384 |
South Asian | 0.000432 | 0.000428 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Major glycoprotein component of a variety of mucus gels. Thought to provide a protective, lubricating barrier against particles and infectious agents at mucosal surfaces. May be involved in ligand binding and intracellular signaling. {ECO:0000269|PubMed:10405327}.;
- Pathway
- Post-translational protein modification;Dectin-2 family;Metabolism of proteins;C-type lectin receptors (CLRs);Innate Immune System;Immune System;Termination of O-glycan biosynthesis;O-linked glycosylation of mucins;O-linked glycosylation
(Consensus)
Haploinsufficiency Scores
- pHI
- hipred
- hipred_score
- ghis
- 0.472
Essentials
- essential_gene_CRISPR
- essential_gene_CRISPR2
- essential_gene_gene_trap
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.259
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | High | Medium | High |
Primary Immunodeficiency | High | High | High |
Cancer | High | High | High |
Mouse Genome Informatics
- Gene name
- Muc3a
- Phenotype
Gene ontology
- Biological process
- stimulatory C-type lectin receptor signaling pathway;O-glycan processing
- Cellular component
- extracellular region;Golgi lumen;plasma membrane;integral component of membrane
- Molecular function
- extracellular matrix structural constituent;extracellular matrix constituent, lubricant activity