MUC4

mucin 4, cell surface associated, the group of Mucins

Basic information

Region (hg38): 3:195746764-195811973

Links

ENSG00000145113 ∙ NCBI:4585 ∙ OMIM:158372 ∙ HGNC:7514 ∙ Uniprot:Q99102 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MUC4 gene.

• not provided (141 variants)
• not specified (11 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MUC4 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				90	3	93
missense			1	38	6	45
nonsense			1			1
start loss						0
frameshift				1	2	3
inframe indel				8		8
splice donor/acceptor (+/-2bp)						0
splice region				2		2
non coding						0
Total	0	0	2	137	11

Variants in MUC4

This is a list of pathogenic ClinVar variants found in the MUC4 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
3-195748967-C-T			Likely benign (Mar 01, 2022)
3-195750908-G-A			Benign (Jul 23, 2018)
3-195750916-C-T			Benign (Feb 26, 2018)
3-195750983-C-T			Likely benign (Jun 01, 2022)
3-195754298-C-G			Likely benign (May 01, 2022)
3-195757306-T-G			Likely benign (Nov 01, 2023)
3-195760897-C-T			Likely benign (Aug 01, 2022)
3-195761590-G-A			Likely benign (Jul 20, 2018)
3-195762232-G-A			Likely benign (Mar 01, 2022)
3-195764168-C-T			Likely benign (Jul 31, 2018)
3-195770264-C-T			Likely benign (May 01, 2022)
3-195778875-T-G			Likely benign (Aug 01, 2023)
3-195778896-G-A			Likely benign (Jan 01, 2023)
3-195778920-A-T			Likely benign (Aug 01, 2023)
3-195778923-T-G			Likely benign (Nov 01, 2023)
3-195778940-TGTCGGTGACAGGAAGAGGGGTGGCGTGACCTGTGGATGCTGAGGAAGTGTCGGTGACAGGAAGAGGGGTGGTGTCACCTGTGGATGCTGAGGAAGTGCTGGTGACAGGAAGAGGGGTGCCGTGACCTGTGGACACTGAGGAAGC-T		Hepatocellular carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
3-195779036-TGCTGGTGACAGGAAGAGGGGTGCCGTGACCTGTGGACACTGAGGAAGC-T		Lung cancer • Small cell lung carcinoma	Pathogenic (Jun 15, 2021)
3-195779058-GCC-G			Likely benign (Aug 01, 2023)
3-195779087-CGGTGACAGGAAGAGAGGTGGTGTGACCTGAGGATGCTGAGGAAGGGAT-C		Hepatocellular carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
3-195779108-T-C			Likely benign (Aug 01, 2023)
3-195779134-A-C			Likely benign (Aug 01, 2023)
3-195779135-TGGTGACAGGAAGAGGCGTGGTGTCACCTGTGGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCAGAGGAAGTGTC-T		Hepatocellular carcinoma	Pathogenic (Jun 15, 2021)
3-195779136-G-A			Likely benign (Aug 01, 2023)
3-195779151-C-CGTGGTGTCACCTGTTGATACTGAGGAAAGGCTGGTGACAGGAAGAGGGGTGGCCTGACCTGTGGATGCCGAGGAAGCGTCGGTGACAGGAAGAGGG		Lung cancer	Pathogenic (Jun 15, 2021)
3-195779214-G-A			Likely benign (May 01, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MUC4	protein_coding	protein_coding	ENST00000463781	25	65513

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.79e-54	0.0000166	125389	0	359	125748	0.00143

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-18.9	5424	2.68e+3	2.03	0.000154	31579
Missense in Polyphen		405	255.78	1.5834		2762
Synonymous	-20.5	2070	1.18e+3	1.76	0.0000839	12685
Loss of Function	1.61	93	111	0.835	0.00000563	1402

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00177	0.00177
Ashkenazi Jewish	0.00302	0.00298
East Asian	0.00269	0.00261
Finnish	0.000140	0.000139
European (Non-Finnish)	0.00169	0.00166
Middle Eastern	0.00269	0.00261
South Asian	0.000990	0.000980
Other	0.00115	0.00114

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May play a role in tumor progression. Ability to promote tumor growth may be mainly due to repression of apoptosis as opposed to proliferation. Has anti-adhesive properties. Seems to alter cellular behavior through both anti-adhesive effects on cell-cell and cell-extracellular matrix interactions and in its ability to act as an intramembrane ligand for ERBB2. Plays an important role in cell proliferation and differentiation of epithelial cells by inducing specific phosphorylation of ERBB2. The MUC4-ERBB2 complex causes site-specific phosphorylation of the ERBB2 'Tyr-1248'. In polarized epithelial cells segregates ERBB2 and other ERBB receptors and prevents ERBB2 from acting as a coreceptor. The interaction with ERBB2 leads to enhanced expression of CDKN1B. The formation of a MUC4-ERBB2-ERBB3-NRG1 complex leads to down-regulation of CDKN1B, resulting in repression of apoptosis and stimulation of proliferation. {ECO:0000269|PubMed:12102554, ECO:0000269|PubMed:16049287, ECO:0000269|PubMed:16814944, ECO:0000269|PubMed:16914178}.
• Pathway: Post-translational protein modification;Dectin-2 family;Metabolism of proteins;C-type lectin receptors (CLRs);Innate Immune System;Immune System;Termination of O-glycan biosynthesis;O-linked glycosylation of mucins;O-linked glycosylation (Consensus)

Intolerance Scores

• loftool: 0.938
• rvis_EVS: 6.32
• rvis_percentile_EVS: 99.86

Haploinsufficiency Scores

• pHI: 0.374
• ghis: 0.438

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.114

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	High	High	High
Primary Immunodeficiency	High	High	High
Cancer	High	High	High

Mouse Genome Informatics

• Gene name: Muc4
• Phenotype: homeostasis/metabolism phenotype; digestive/alimentary phenotype; neoplasm; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); immune system phenotype

Gene ontology

• Biological process: stimulatory C-type lectin receptor signaling pathway;cell-matrix adhesion;regulation of signaling receptor activity;O-glycan processing;maintenance of gastrointestinal epithelium
• Cellular component: extracellular space;Golgi lumen;plasma membrane;integral component of plasma membrane;membrane;extracellular matrix;vesicle;extracellular exosome
• Molecular function: ErbB-2 class receptor binding;extracellular matrix constituent, lubricant activity