MUC6

mucin 6, oligomeric mucus/gel-forming, the group of Mucins

Basic information

Region (hg38): 11:1012823-1036718

Links

ENSG00000184956 ∙ NCBI:4588 ∙ OMIM:158374 ∙ HGNC:7517 ∙ Uniprot:Q6W4X9 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the MUC6 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the MUC6 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				14		14
missense						0
nonsense						0
start loss						0
frameshift						0
inframe indel					1	1
splice donor/acceptor (+/-2bp)						0
splice region				1		1
non coding						0
Total	0	0	0	14	1

Variants in MUC6

This is a list of pathogenic ClinVar variants found in the MUC6 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
11-1016237-C-T			Likely benign (Nov 01, 2023)
11-1016825-G-A			Likely benign (Aug 01, 2023)
11-1016890-G-A			not provided (-)
11-1016972-GGTGT-G		Lung cancer	Pathogenic (Jun 15, 2021)
11-1017036-G-GCA		Small cell lung carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
11-1017040-GGT-G		Small cell lung carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
11-1017041-G-A			Likely benign (May 01, 2023)
11-1017134-G-T			Likely benign (Aug 01, 2023)
11-1017191-G-A			Likely benign (Aug 01, 2023)
11-1017203-A-G			Likely benign (Aug 01, 2023)
11-1017463-TTCTG-T		Lung cancer	Pathogenic (Jun 15, 2021)
11-1017463-TTCTGGTGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTG-T		Lung cancer	Pathogenic (Jun 15, 2021)
11-1017466-T-A		Small cell lung carcinoma • Lung cancer	Pathogenic (Jun 15, 2021)
11-1017469-TGCCTGTACTGGTGTGGTTGGGGGTGATGCTGGTGGTAGAAGTTGAGGTGACTTCAGGATGGTGTGTGGAGGAAGTGTGTGAATGTAGGGATGTAGAGGTTTTGGCCGTGCTAAATGAGCTTCGGGATTGGCTGGTC-T		Lung cancer	Pathogenic (Jun 15, 2021)
11-1017495-ATGC-A		Lung cancer	Pathogenic (Jun 15, 2021)
11-1017566-G-A			Likely benign (Aug 01, 2023)
11-1017608-ACTGGTGGTCACTGTCATTGGTGG-A		Lung cancer	Pathogenic (Jun 15, 2021)
11-1018167-ATCG-A		not specified	Benign (Mar 29, 2016)
11-1018224-T-A			not provided (-)
11-1018264-G-GA		Lung cancer	Pathogenic (Jun 15, 2021)
11-1018274-G-C			Likely benign (Aug 01, 2023)
11-1018331-G-C			Likely benign (Aug 01, 2023)
11-1018400-G-A			Likely benign (Aug 01, 2023)
11-1018406-A-T			Likely benign (Aug 01, 2023)
11-1018419-G-A		Malignant tumor of prostate	Uncertain significance (-)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
MUC6	protein_coding	protein_coding	ENST00000421673	33	23886

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.21e-39	0.00282	124809	3	565	125377	0.00227

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.914	1263	1.36e+3	0.930	0.0000878	14736
Missense in Polyphen		49	73.028	0.67097		925
Synonymous	-0.328	631	621	1.02	0.0000475	5054
Loss of Function	1.77	70	87.9	0.796	0.00000454	942

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00311	0.00307
Ashkenazi Jewish	0.000402	0.000397
East Asian	0.00143	0.00137
Finnish	0.00154	0.00153
European (Non-Finnish)	0.00328	0.00317
Middle Eastern	0.00143	0.00137
South Asian	0.00146	0.00134
Other	0.00201	0.00196

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May provide a mechanism for modulation of the composition of the protective mucus layer related to acid secretion or the presence of bacteria and noxious agents in the lumen. Plays an important role in the cytoprotection of epithelial surfaces and are used as tumor markers in a variety of cancers. May play a role in epithelial organogenesis. {ECO:0000269|PubMed:10209489, ECO:0000269|PubMed:10330458, ECO:0000269|PubMed:11988092}.
• Pathway: Gastric acid production;Post-translational protein modification;Dectin-2 family;Metabolism of proteins;C-type lectin receptors (CLRs);Innate Immune System;Immune System;Termination of O-glycan biosynthesis;O-linked glycosylation of mucins;O-linked glycosylation (Consensus)

Recessive Scores

• pRec: 0.177

Intolerance Scores

• loftool: 0.987
• rvis_EVS: 1.26
• rvis_percentile_EVS: 93.57

Haploinsufficiency Scores

• pHI: 0.161
• hipred: N
• hipred_score: 0.123

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.126

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	High	High	High
Primary Immunodeficiency	High	High	High
Cancer	High	High	High

Mouse Genome Informatics

• Gene name: Muc6

Gene ontology

• Biological process: stimulatory C-type lectin receptor signaling pathway;O-glycan processing;maintenance of gastrointestinal epithelium
• Cellular component: extracellular region;Golgi lumen;plasma membrane
• Molecular function: extracellular matrix structural constituent