NDUFA10

NADH:ubiquinone oxidoreductase subunit A10, the group of NADH:ubiquinone oxidoreductase supernumerary subunits

Basic information

Region (hg38): 2:239892450-240025743

Links

ENSG00000130414

∙ NCBI:4705 ∙ OMIM:603835 ∙ HGNC:7684 ∙ Uniprot:O95299 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

Leigh syndrome (Strong), mode of inheritance: AR
Leigh syndrome with leukodystrophy (Supportive), mode of inheritance: AR
mitochondrial complex 1 deficiency, nuclear type 22 (Strong), mode of inheritance: AR
mitochondrial disease (Moderate), mode of inheritance: AR
Leigh syndrome (Limited), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Mitochondrial complex I deficiency, nuclear type 22; Leigh syndrome	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Biochemical; Cardiovascular; Gastrointestinal; Neurologic; Ophthalmologic	11743516; 21150889
Medical treatment (eg, riboflavin, ubiquinol) may be beneficial; Individuals may have cardiac involvement

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the NDUFA10 gene.

Inborn genetic diseases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the NDUFA10 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			4 clinvar	24 clinvar	3 clinvar	31
missense		2 clinvar	66 clinvar	5 clinvar	1 clinvar	74
nonsense				1 clinvar		1
start loss		1 clinvar				1
frameshift	1 clinvar		2 clinvar			3
inframe indel			1 clinvar			1
splice donor/acceptor (+/-2bp)		1 clinvar	1 clinvar			2
splice region			3	7	1	11
non coding			93 clinvar	46 clinvar	47 clinvar	186
Total	1	4	167	76	51

Highest pathogenic variant AF is 0.0000263

Variants in NDUFA10

This is a list of pathogenic ClinVar variants found in the NDUFA10 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Phenotype	Significance	ClinVar
2-239895291-T-C		Benign (Oct 01, 2022)	2652082
2-239921636-TGCATTTTACAAACCTCTTGCTACTACAGAGCACTGATTGGC-T	Schizophrenia	Uncertain significance (Nov 11, 2022)	1801460
2-239925791-AAGAAGGTCTCAAATCTCAACAATGATCAGCTCAGTCCAGTTAGAAAATGTGCAAAAGACATGAACAGATATTTCACAAAGAGGATATACAGATTAGCACATGAAAACATGTTAACATCACCAGTCACTAGAGAAATGAAGACCACAATGAAATATCACTATACATCTTTCAGAGCAACTAAAATTAAAAATAGAGACCACACCAAAGCCTGACGAGGATGCTGAGAGATTGTCCTTCACACATCATTGGTGGGAATGTAAGGTGGTACCCCACTCTGGGAAACATTTTGGAGTCTCTGATAAAAAATTAAACATACACTTACCCTACGATCCAGCAATTACACTTCTGGGCATTTACACCAGAGGAATGAAACTTTCTGTCTACACAAAAACTTGTATATCAATGTTCATAGCGGCTTTATTCATAATTGTCAAAATCTGGAAACGATGTCAATTTCCTTCAATGGGTGAATGGTTAAACAAACTGTGGTACACTGGTAATGTGAGCTCAGCAATAAACAGAAAAAACTAGCATACAATGCTTCAGTCAACAACAGACCAAATATGCTACAGTGGTCCCATGAGACTATAATGAAGCTGAAGAAATCCTATCCCCTAGTGACACTGTAGCCAGCATATGTCATAGCTTGTCTGTGATGAGGCTGGTGTAAGCAAACCTACTGTGTGCCAGTCATATACAAGTCTAGCACATGCAATTATGTACAGTACATAATACTGATGAAAATAACTGACGATATTTCTGGATTATATTTTTAGTACACTATACTTTTTATCATAATTTTGGAGTGTACTCCTCCTACTTATAAAAAAAAATAGATACCTGTAAAACAGCCTCAGATAAGTCCTTCAGGAGGTATTCAGAAGAAGGCATCATTACCACAGGGGAGAACAATTCCATGTGTGCTACTGCTCCTGAAGACCTTCCAGTGGGACAGGAGGTGGAGGTGGAAGACAGTGACGTCATATTAGTCTGTCCTCATGCTGCTAATAAAGACGTACCCGAGACCGGGTAATTCATAAAGGAAAGAGGTTTAATGGACTCACAGTTCCACATGGCTGGGGAGGCCTCACAATCATGGTGGAGAGCGAAGGGGAAGCAAGACACGTCTTACATGGTGGCAGGCAAGAAAGTGTGTGCAGGGGAGCTTCTCTTTATAAAACCACCAGATCCCATGAGACTGATTCACTGTGACAAGAACAGCATGGGAAAGATCCACCCCCACGATTCAACGGCCTCCCACCAGGTCCCTCCCACAACACATGGGGATTATGGGAGCTACAATTCAAGATGAGACTTGGGTGGGGACACAGTTATACCCTATCAGACATGGATGATCCTGACCGTATGTAGACCTAGGCTAATGTGTGCATTTGTGCCTTAGTATTTTTTTAAAGTTTTAAAAGTTAAAAAAGTAATAGAATAAAGCTTATAGAATAAGGATATGAAGAAAGAATATAGAGCTGTAACATGTATTTTAAGGTAAATGTTATTATAAAAGAGTCAGAAAGTTAAAAAATATCAAAAAGTGTATGAAGTAAAAGACTTAGAGTAAGCTAAGGTTAGCTTACTGAAGAAAGAAAACTTTTAACGATAAATTGAGTTTAGCCTAAGTGTGCAATGTCTATAAAGTCTGCAGCAGTGCACAGTCATGTCCCAGGCCCTCACGTTCACTCCCCACCCACTGGCTGACTCACCGACCTAACGGTGCAGTCCTCAGGATGTATCCCCGTCATTACACAAAGCATGACTGTATTGCCACTCTCACAGCCTGGAGGGGGCTCAAGGGCATTAGGCTGAATTTTAAAAGTTAATCTCTAAAGGTCACATGCCGCACAATTCCATTTATACAAAATTCTCAAAATGACAAAATCACAGAGCTGCAGAACAGCTTCCTGGTTGCCAGGGTTAGGGGTGGGGCAAGGGGAGGAGCCTGGGTGGCGACTGGGGACAGCCTGAGGGAGATTCACACGATGACATCAGCGTGGCAGCCGCCACAGGTGGCAAAATTCTATAAAACCACATGGAACAACAAATGAGTGTGAGGAAAGCTGGCAAAAACTCGGCAAGGCTGGTGGGCCCATCACTGTCAGGTCCCTGGTACCCCAATACGGTGGCTGTGGGGGTGCTGGGCAAGGACACAGGGGACTTCTGCATGCTGCGTTTGCAATTTCTTGTGCATGTGTAGTCATCAAATTAAAAGTTAAAAGCAAAGACACAAAACACCAGTACCCAGGTAAAGAGCGACTGAAGTCAAGAAGGGCCCTCCCATCC-A	Schizophrenia	Uncertain significance (Nov 11, 2022)	1801470
2-239957394-C-T	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 13, 2018)	896660
2-239957407-T-C	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 12, 2018)	896661
2-239957561-C-T	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 13, 2018)	335151
2-239957574-G-A	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Benign/Likely benign (Jan 13, 2018)	897120
2-239957628-C-G	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 13, 2018)	897121
2-239957662-A-C	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Apr 27, 2017)	897122
2-239957668-C-T	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Benign (Jan 13, 2018)	335152
2-239957709-C-T	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Jan 12, 2018)	898284
2-239957710-A-G	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 12, 2018)	335153
2-239957715-T-C	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Apr 28, 2017)	895289
2-239957769-C-T	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Benign/Likely benign (Jan 13, 2018)	335154
2-239957771-G-A	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 13, 2018)	895290
2-239957817-G-A	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 12, 2018)	895291
2-239957913-C-T	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Jan 12, 2018)	335155
2-239957914-G-A	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Benign (Jan 13, 2018)	335156
2-239957943-A-C	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Jan 13, 2018)	896710
2-239957975-G-A	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Mar 16, 2018)	896711
2-239957977-G-A	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Jan 13, 2018)	335157
2-239958005-C-T	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 13, 2018)	335158
2-239958020-T-A	Leigh syndrome • Mitochondrial complex I deficiency, nuclear type 1	Uncertain significance (Jan 12, 2018)	335159
2-239958023-T-C	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Uncertain significance (Jan 12, 2018)	897183
2-239958043-A-C	Mitochondrial complex I deficiency, nuclear type 1 • Leigh syndrome	Benign/Likely benign (Jan 13, 2018)	335160

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
NDUFA10	protein_coding	protein_coding	ENST00000252711	10	132953

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
6.24e-8	0.681	125711	0	37	125748	0.000147

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.362	206	192	1.07	0.0000116	2315
Missense in Polyphen		65	67.017	0.9699		793
Synonymous	0.142	73	74.6	0.979	0.00000478	651
Loss of Function	1.23	14	20.0	0.702	0.00000103	242

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000517	0.000517
Ashkenazi Jewish	0.00	0.00
East Asian	0.000109	0.000109
Finnish	0.0000924	0.0000924
European (Non-Finnish)	0.000132	0.000123
Middle Eastern	0.000109	0.000109
South Asian	0.000229	0.000229
Other	0.000326	0.000326

dbNSFP

Source: dbNSFP

Function: FUNCTION: Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. {ECO:0000269|PubMed:27626371}.;
Disease: DISEASE: Leigh syndrome (LS) [MIM:256000]: An early-onset progressive neurodegenerative disorder characterized by the presence of focal, bilateral lesions in one or more areas of the central nervous system including the brainstem, thalamus, basal ganglia, cerebellum and spinal cord. Clinical features depend on which areas of the central nervous system are involved and include subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, and dysphagia. {ECO:0000269|PubMed:21150889}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
Pathway: Retrograde endocannabinoid signaling - Homo sapiens (human);Non-alcoholic fatty liver disease (NAFLD) - Homo sapiens (human);Alzheimer,s disease - Homo sapiens (human);Huntington,s disease - Homo sapiens (human);Thermogenesis - Homo sapiens (human);Oxidative phosphorylation - Homo sapiens (human);Parkinson,s disease - Homo sapiens (human);Electron Transport Chain;Oxidative phosphorylation;Respiratory electron transport;The citric acid (TCA) cycle and respiratory electron transport;Metabolism;Complex I biogenesis;Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins. (Consensus)

Recessive Scores

pRec: 0.110

Intolerance Scores

loftool: 0.262
rvis_EVS: 0.06
rvis_percentile_EVS: 58.53

Haploinsufficiency Scores

pHI: 0.0669
hipred: N
hipred_score: 0.250
ghis: 0.481

Essentials

essential_gene_CRISPR: N
essential_gene_CRISPR2: S
essential_gene_gene_trap: N
gene_indispensability_pred: E
gene_indispensability_score: 0.962

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

Gene name: Ndufa10
Phenotype

Gene ontology

Biological process: mitochondrial electron transport, NADH to ubiquinone;mitochondrial respiratory chain complex I assembly
Cellular component: cytoplasm;mitochondrion;mitochondrial inner membrane;mitochondrial respiratory chain complex I;mitochondrial matrix;myelin sheath
Molecular function: NADH dehydrogenase (ubiquinone) activity