NICN1

nicolin 1, tubulin polyglutamylase complex subunit, the group of Tubulin polyglutamylase complex subunits

Basic information

Region (hg38): 3:49422332-49429326

Links

ENSG00000145029 ∙ NCBI:84276 ∙ OMIM:611516 ∙ HGNC:18317 ∙ Uniprot:Q9BSH3 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the NICN1 gene.

• Non-ketotic hyperglycinemia (8 variants)
• Glycine encephalopathy 2 (1 variants)
• Glycine encephalopathy 1 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the NICN1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			5	1		6
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding	8	6	30	20	3	67
Total	8	6	35	21	3

Highest pathogenic variant AF is 0.00000658

Variants in NICN1

This is a list of pathogenic ClinVar variants found in the NICN1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
3-49422341-A-G		Non-ketotic hyperglycinemia	Likely benign (Nov 28, 2022)
3-49422348-C-T		Non-ketotic hyperglycinemia	Likely benign (Nov 24, 2023)
3-49422349-C-T		Non-ketotic hyperglycinemia	Likely benign (Nov 28, 2023)
3-49422351-T-A		Non-ketotic hyperglycinemia	Likely benign (Sep 07, 2022)
3-49422351-T-C		Non-ketotic hyperglycinemia	Likely benign (Jul 30, 2022)
3-49422352-C-G		Non-ketotic hyperglycinemia	Likely benign (Aug 29, 2023)
3-49422356-C-G		Non-ketotic hyperglycinemia	Uncertain significance (Apr 10, 2022)
3-49422357-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Apr 27, 2021)
3-49422360-C-A		Non-ketotic hyperglycinemia	Likely pathogenic (May 03, 2022)
3-49422364-T-C		Non-ketotic hyperglycinemia	Likely benign (May 31, 2022)
3-49422364-TGCGCAACTAAGTGGACGACACAAGGCCGGGGGGAATGCCTGCAGGCGAAAGCCCAGACGGGCCACCACACTTACAGCCCTCTGCATCGTCGCCTGCAACGAGTGCAGACG-T		Non-ketotic hyperglycinemia	Likely pathogenic (Nov 03, 2020)
3-49422365-G-A		Non-ketotic hyperglycinemia	Uncertain significance (Jan 13, 2018)
3-49422367-G-A		Non-ketotic hyperglycinemia	Conflicting classifications of pathogenicity (Jan 08, 2024)
3-49422370-A-G		Non-ketotic hyperglycinemia	Likely benign (Feb 05, 2023)
3-49422373-A-G		Non-ketotic hyperglycinemia	Likely benign (Nov 10, 2023)
3-49422374-A-T		Non-ketotic hyperglycinemia • Inborn genetic diseases	Uncertain significance (Feb 23, 2023)
3-49422376-T-C		Non-ketotic hyperglycinemia	Likely benign (Dec 12, 2022)
3-49422376-TG-T		Non-ketotic hyperglycinemia	Pathogenic (Jul 03, 2022)
3-49422378-G-A		Non-ketotic hyperglycinemia	Uncertain significance (Dec 20, 2020)
3-49422381-G-A		Non-ketotic hyperglycinemia	Uncertain significance (Jan 14, 2022)
3-49422381-G-C		Non-ketotic hyperglycinemia	Uncertain significance (Jun 18, 2022)
3-49422384-A-G		Non-ketotic hyperglycinemia	Uncertain significance (May 19, 2022)
3-49422385-C-T		Non-ketotic hyperglycinemia	Likely benign (Jul 27, 2021)
3-49422387-AG-A		Non-ketotic hyperglycinemia	Likely pathogenic (-)
3-49422389-G-A		Non-ketotic hyperglycinemia	Uncertain significance (Jan 17, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
NICN1	protein_coding	protein_coding	ENST00000273598	6	6381

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0388	0.933	125726	0	17	125743	0.0000676

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.769	106	131	0.811	0.00000761	1367
Missense in Polyphen		31	45.304	0.68427		507
Synonymous	-0.918	60	51.6	1.16	0.00000275	440
Loss of Function	1.90	4	10.7	0.374	4.55e-7	122

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000177	0.000177
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000555	0.0000544
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.0000621	0.0000615
Middle Eastern	0.0000555	0.0000544
South Asian	0.000164	0.000163
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Pathway: Post-translational protein modification;Metabolism of proteins;Carboxyterminal post-translational modifications of tubulin (Consensus)

Recessive Scores

• pRec: 0.101

Intolerance Scores

• loftool: 0.403
• rvis_EVS: -0.16
• rvis_percentile_EVS: 41.64

Haploinsufficiency Scores

• pHI: 0.161
• hipred: N
• hipred_score: 0.319
• ghis: 0.565

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.186

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Nicn1

Gene ontology

• Cellular component: nucleoplasm;microtubule