NR0B1

nuclear receptor subfamily 0 group B member 1, the group of Nuclear receptor subfamily 0 group B

Basic information

Region (hg38): X:30304205-30309390

Previous symbols: [ "AHC", "DSS" ]

Links

ENSG00000169297 ∙ NCBI:190 ∙ OMIM:300473 ∙ HGNC:7960 ∙ Uniprot:P51843 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• X-linked adrenal hypoplasia congenita (Definitive), mode of inheritance: XL
• 46,XY sex reversal 2 (Moderate), mode of inheritance: XL
• X-linked adrenal hypoplasia congenita (Definitive), mode of inheritance: XL
• X-linked adrenal hypoplasia congenita (Supportive), mode of inheritance: XL
• X-linked adrenal hypoplasia congenita (Strong), mode of inheritance: XL
• X-linked adrenal hypoplasia congenita (Definitive), mode of inheritance: XL

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Adrenal hypoplasia, congenital; 46,XY sex reversal 2	XL	Endocrine; Genitourinary; Obstetric; Oncologic	Affected individuals typically present in infancy with acute-onset adrenal insufficiency, which can be lethal, and preventive and treatment measures can be effective	Endocrine; Genitourinary; Obstetric; Oncologic	6891556; 7951319; 7990958; 9003500; 9529340; 10022408; 11549627; 11788621; 12519885; 17503084; 17164309; 20301604; 20301714; 21408189; 21632081; 21739173; 21925982; 22456342; 22570964
Digenic inheritance (with GNRH1) has been reported; Dosage-sensitive sex reversal has been described due to duplications

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the NR0B1 gene.

• Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2 (69 variants)
• Congenital adrenal hypoplasia, X-linked (50 variants)
• not provided (42 variants)
• 46,XY sex reversal 2;Congenital adrenal hypoplasia, X-linked (16 variants)
• Inborn genetic diseases (9 variants)
• not specified (8 variants)
• NR0B1-related condition (6 variants)
• NR0B1-related disorder (1 variants)
• Mineralocorticoid deficiency, isolated (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the NR0B1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				25	9	34
missense	4	5	36	7	6	58
nonsense	21	2	1			24
start loss		1				1
frameshift	29	5				34
inframe indel						0
splice donor/acceptor (+/-2bp)	4	1				5
splice region					1	1
non coding					2	2
Total	58	14	37	32	17

Variants in NR0B1

This is a list of pathogenic ClinVar variants found in the NR0B1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-30304336-AT-A			Benign (Apr 09, 2019)
X-30304562-GTGTGGCCCACATGACTTTATATCTTTGTACAGAGCATTTCCAGCATCATATCATCCATGCTGACTGTGCCGATGATGGGCCTGAAGAACAGTTCAGCAATGACATTGGCATTGATGAATCTCAGCAGGAAAAGGGTACTATTAAGTTCGATGAATCTGTCATGGGGCCCTTGGTGCGTCATCCTGGTGTGTTCACTGAGTATTTGCTGAGTTCCCCACTGGAGTCCCTGAATGTACTTCACGCACTGCAGGCCCGGCACGTCTGGAGGGAGAAAAATCTCTTTGTTATAAAACAGCTCACCACAGAGTCCTTTGCTAGCTTTTTAAAAATAGCCATTTCTGTTTCATCCCAATTAAACAAGACCCAAAGCTTC-CA		Congenital adrenal hypoplasia, X-linked	Pathogenic (Oct 17, 2017)
X-30304581-A-G		Congenital adrenal hypoplasia, X-linked	Likely pathogenic (Sep 27, 2016)
X-30304582-T-C		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2 • NR0B1-related disorder	Benign/Likely benign (Jan 19, 2024)
X-30304594-G-C		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Likely benign (Nov 09, 2023)
X-30304615-AT-C		Congenital adrenal hypoplasia, X-linked	Pathogenic (Oct 01, 1996)
X-30304626-CTG-C		Congenital adrenal hypoplasia, X-linked	Pathogenic (Mar 05, 2009)
X-30304627-T-C		not specified • Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2 • NR0B1-related disorder	Benign/Likely benign (Jan 21, 2024)
X-30304633-G-A		46,XY sex reversal 2;Congenital adrenal hypoplasia, X-linked	Benign (Jan 24, 2024)
X-30304638-T-A			Uncertain significance (Sep 16, 2018)
X-30304638-T-C		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Uncertain significance (Jan 07, 2024)
X-30304641-G-C		Inborn genetic diseases	Uncertain significance (Nov 21, 2022)
X-30304641-GC-G		Congenital adrenal hypoplasia, X-linked	Pathogenic (Oct 19, 2020)
X-30304646-A-G		Congenital adrenal hypoplasia, X-linked	Uncertain significance (Oct 08, 2021)
X-30304652-A-G		Congenital adrenal hypoplasia, X-linked	Pathogenic (May 18, 2016)
X-30304669-G-C		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Likely benign (Mar 19, 2023)
X-30304673-T-A		Congenital adrenal hypoplasia, X-linked	Pathogenic (Jul 01, 2000)
X-30304676-A-C		Congenital adrenal hypoplasia, X-linked	Pathogenic (Feb 01, 2000)
X-30304684-C-T		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Likely benign (Aug 09, 2021)
X-30304690-GA-G			Pathogenic (May 20, 2016)
X-30304693-A-G		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Likely benign (Aug 16, 2023)
X-30304696-GGTACTATTAA-G		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Pathogenic (Jul 06, 2022)
X-30304699-AC-A		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Pathogenic (Jun 22, 2022)
X-30304711-G-A		46,XY sex reversal 2;Congenital adrenal hypoplasia, X-linked	Likely benign (Apr 15, 2023)
X-30304713-T-C		Congenital adrenal hypoplasia, X-linked;46,XY sex reversal 2	Likely benign (May 09, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
NR0B1	protein_coding	protein_coding	ENST00000378970	2	5393

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.970	0.0297	123291	0	1	123292	0.00000406

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.08	150	192	0.780	0.0000132	3013
Missense in Polyphen		30	58.75	0.51063		1073
Synonymous	-0.841	99	88.9	1.11	0.00000644	986
Loss of Function	3.06	0	10.9	0.00	6.93e-7	165

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000366	0.0000366
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Orphan nuclear receptor. Component of a cascade required for the development of the hypothalamic-pituitary-adrenal-gonadal axis. Acts as a coregulatory protein that inhibits the transcriptional activity of other nuclear receptors through heterodimeric interactions. May also have a role in the development of the embryo and in the maintenance of embryonic stem cell pluripotency (By similarity). {ECO:0000250}.
• Disease: DISEASE: Adrenal hypoplasia, congenital (AHC) [MIM:300200]: A disorder of adrenal gland development characterized by absence of the permanent zone of the adrenal cortex, structural disorganization of the adrenal glands, adrenal insufficiency and profound hormonal deficiencies. AHC patients manifest primary adrenal failure usually in early infancy, and hypogonadotropic hypogonadism leading to absent or incomplete sexual maturation. AHC can be inherited in an X-linked or autosomal recessive pattern. {ECO:0000269|PubMed:10323730, ECO:0000269|PubMed:10341858, ECO:0000269|PubMed:10675358, ECO:0000269|PubMed:10848616, ECO:0000269|PubMed:11113848, ECO:0000269|PubMed:11443184, ECO:0000269|PubMed:11748852, ECO:0000269|PubMed:11788621, ECO:0000269|PubMed:12629128, ECO:0000269|PubMed:15800903, ECO:0000269|PubMed:7990958, ECO:0000269|PubMed:9003500, ECO:0000269|PubMed:9063431, ECO:0000269|PubMed:9360549, ECO:0000269|PubMed:9415399, ECO:0000269|PubMed:9529340}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: 46,XY sex reversal 2 (SRXY2) [MIM:300018]: A condition characterized by male-to-female sex reversal in the presence of a normal 46,XY karyotype. {ECO:0000269|PubMed:9486644}. Note=The disease is caused by mutations affecting the gene represented in this entry. XY individuals with a duplication of part of the short arm of the X chromosome and an intact SRY gene develop as females. The single X chromosome in these individuals does not undergo X- chromosome inactivation; therefore, these individuals presumably carry 2 active copies of genes, including the NR0B1 gene, in the duplicated region. Individuals with deletion of this region develop as males. Genes within the dosage-sensitive sex reversal region are, therefore, not essential for testis development, but, when present in a double dose, interfere with testis formation.
• Pathway: NHR;Nuclear Receptors;Gene expression (Transcription);Generic Transcription Pathway;Nuclear Receptor transcription pathway;RNA Polymerase II Transcription;Validated nuclear estrogen receptor alpha network;Regulation of Androgen receptor activity;Validated nuclear estrogen receptor beta network (Consensus)

Recessive Scores

• pRec: 0.610

Intolerance Scores

• loftool: 0.0263
• rvis_EVS: -0.49
• rvis_percentile_EVS: 22.09

Haploinsufficiency Scores

• pHI: 0.641
• hipred: Y
• hipred_score: 0.511
• ghis: 0.452

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.787

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Nr0b1
• Phenotype: homeostasis/metabolism phenotype; endocrine/exocrine gland phenotype; reproductive system phenotype; neoplasm

Zebrafish Information Network

• Gene name: nr0b1
• Affected structure: somatic cell
• Phenotype tag: abnormal
• Phenotype quality: decreased occurrence

Gene ontology

• Biological process: negative regulation of transcription by RNA polymerase II;transcription initiation from RNA polymerase II promoter;steroid biosynthetic process;spermatogenesis;protein localization;gonad development;male gonad development;hypothalamus development;pituitary gland development;male sex determination;adrenal gland development;intracellular receptor signaling pathway;negative regulation of intracellular steroid hormone receptor signaling pathway;Leydig cell differentiation;response to immobilization stress;steroid hormone mediated signaling pathway;negative regulation of DNA-binding transcription factor activity;negative regulation of cell differentiation;negative regulation of transcription, DNA-templated;Sertoli cell differentiation
• Cellular component: nucleus;nucleoplasm;cytoplasm;microtubule organizing center;membrane;nuclear speck;polysomal ribosome;intracellular membrane-bounded organelle
• Molecular function: DNA-binding transcription factor activity, RNA polymerase II-specific;DNA binding;steroid hormone receptor activity;transcription corepressor activity;RNA binding;nuclear receptor activity;protein binding;transcription factor binding;protein domain specific binding;DNA hairpin binding;steroid hormone receptor binding;protein homodimerization activity;sequence-specific DNA binding