OPN1MW
Basic information
Region (hg38): X:154182596-154196861
Previous symbols: [ "GCP", "CBBM", "CBD" ]
Links
Phenotypes
GenCC
Source:
- blue cone monochromacy (Supportive), mode of inheritance: XL
- cone-rod dystrophy (Supportive), mode of inheritance: AD
- blue cone monochromacy (Definitive), mode of inheritance: Mitochondrial
- red-green color blindness (Strong), mode of inheritance: XL
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Colorblindness, partial, deutan series; Cone dystrophy 5, X-linked; Blue cone monochromacy | XL (involving both OPN1 genes) | General | Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing | Ophthalmologic | 2788922; 1881435; 1302020; 8213841; 8666378; 10982039; 11772996; 15094734; 19421413; 20579627; 23139274 |
ClinVar
This is a list of variants' phenotypes submitted to
- Achromatopsia (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the OPN1MW gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 0 | |||||
missense | 11 | |||||
nonsense | 0 | |||||
start loss | 0 | |||||
frameshift | 1 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region | 0 | |||||
non coding | 0 | |||||
Total | 1 | 0 | 5 | 6 | 0 |
Variants in OPN1MW
This is a list of pathogenic ClinVar variants found in the OPN1MW region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
X-154187851-T-C | not specified | Likely benign (-) | ||
X-154187917-C-T | not specified | Uncertain significance (Feb 22, 2024) | ||
X-154187932-T-C | not specified | Uncertain significance (Jan 23, 2024) | ||
X-154187939-C-A | Deuteranomaly | Pathogenic (Jun 07, 2002) | ||
X-154187964-A-G | Likely benign (Feb 01, 2024) | |||
X-154187988-G-A | Likely benign (-) | |||
X-154187989-T-C | not specified | Uncertain significance (Apr 26, 2023) | ||
X-154188004-A-C | not specified | Likely benign (Feb 16, 2023) | ||
X-154190101-A-C | Likely benign (-) | |||
X-154190109-C-G | Benign (-) | |||
X-154190165-C-T | not specified | Benign/Likely benign (Jan 01, 2024) | ||
X-154190173-T-C | Cone dystrophy 5, X-linked | Pathogenic (Jul 09, 2010) | ||
X-154190176-A-G | Likely benign (Jan 01, 2024) | |||
X-154190182-G-T | not specified | Benign (-) | ||
X-154191716-T-C | Cone monochromatism • Deuteranomaly | Pathogenic (Jan 01, 2009) | ||
X-154193469-TGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGCTGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATC-T | Achromatopsia | Pathogenic (Jun 18, 2021) | ||
X-154193486-C-G | not specified | Uncertain significance (Nov 08, 2024) | ||
X-154193498-T-G | not specified | Likely benign (Sep 23, 2023) | ||
X-154193517-C-A | not specified | Uncertain significance (Jul 31, 2024) | ||
X-154193621-G-A | not specified | Likely benign (Jul 15, 2021) | ||
X-154193630-G-C | not specified | Uncertain significance (Nov 15, 2024) | ||
X-154195934-G-A | Deuteranomaly | Pathogenic (Jun 07, 2002) | ||
X-154195958-G-T | not specified | Uncertain significance (Nov 23, 2024) | ||
X-154195969-G-C | not specified | Uncertain significance (Nov 09, 2024) | ||
X-154195991-G-C | not specified | Uncertain significance (Sep 11, 2024) |
GnomAD
Source:
dbNSFP
Source:
- Function
- FUNCTION: Visual pigments are the light-absorbing molecules that mediate vision. They consist of an apoprotein, opsin, covalently linked to cis-retinal. {ECO:0000305|PubMed:12051694, ECO:0000305|PubMed:1302020, ECO:0000305|PubMed:2937147}.;
- Disease
- DISEASE: Colorblindness, partial, deutan series (CBD) [MIM:303800]: A color vision defect characterized by a dichromasy in which red and green are confused, without loss of luminance or shift or shortening of the spectrum. Dichromasy is due to the use of only two types of photoreceptors, blue plus red in deuteranopia and blue plus green in protanopia. {ECO:0000269|PubMed:12051694, ECO:0000269|PubMed:1302020}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Blue cone monochromacy (BCM) [MIM:303700]: A rare X- linked congenital stationary cone dysfunction syndrome characterized by the absence of functional long wavelength- sensitive and medium wavelength-sensitive cones in the retina. Color discrimination is severely impaired from birth, and vision is derived from the remaining preserved blue (S) cones and rod photoreceptors. BCM typically presents with reduced visual acuity, pendular nystagmus, and photophobia. Patients often have myopia. {ECO:0000269|PubMed:8666378}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Cone dystrophy 5 (COD5) [MIM:303700]: A X-linked cone dystrophy. Cone dystrophies are retinal dystrophies characterized by progressive degeneration of the cone photoreceptors with preservation of rod function, as indicated by electroretinogram. However, some rod involvement may be present in some cone dystrophies, particularly at late stage. Affected individuals suffer from photophobia, loss of visual acuity, color vision and central visual field. Another sign is the absence of macular lesions for many years. Cone dystrophies are distinguished from the cone-rod dystrophies in which some loss of peripheral vision also occurs. {ECO:0000269|PubMed:20579627}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- GPCRs, Class A Rhodopsin-like;Signaling by GPCR;Signal Transduction;Opsins;Class A/1 (Rhodopsin-like receptors);GPCR ligand binding;The retinoid cycle in cones (daylight vision);G alpha (i) signalling events;Visual phototransduction;GPCR downstream signalling
(Consensus)
Recessive Scores
- pRec
- 0.145
Haploinsufficiency Scores
- pHI
- 0.103
- hipred
- N
- hipred_score
- 0.187
- ghis
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.114
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Gene ontology
- Biological process
- retinoid metabolic process;G protein-coupled receptor signaling pathway;visual perception;phototransduction;detection of visible light;protein-chromophore linkage;positive regulation of cytokinesis;cellular response to light stimulus
- Cellular component
- photoreceptor outer segment;plasma membrane;integral component of plasma membrane;photoreceptor disc membrane
- Molecular function
- G protein-coupled photoreceptor activity;photoreceptor activity;identical protein binding