OPN1MW

opsin 1, medium wave sensitive, the group of Opsin receptors

Basic information

Region (hg38): X:154182595-154196861

Previous symbols: [ "GCP", "CBBM", "CBD" ]

Links

ENSG00000268221 ∙ NCBI:2652 ∙ OMIM:300821 ∙ HGNC:4206 ∙ Uniprot:P04001 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• blue cone monochromacy (Supportive), mode of inheritance: XL
• cone-rod dystrophy (Supportive), mode of inheritance: AD
• blue cone monochromacy (Definitive), mode of inheritance: Mitochondrial
• red-green color blindness (Strong), mode of inheritance: XL

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Colorblindness, partial, deutan series; Cone dystrophy 5, X-linked; Blue cone monochromacy	XL (involving both OPN1 genes)	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Ophthalmologic	2788922; 1881435; 1302020; 8213841; 8666378; 10982039; 11772996; 15094734; 19421413; 20579627; 23139274

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the OPN1MW gene.

• Inborn genetic diseases (4 variants)
• not provided (1 variants)
• Achromatopsia (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the OPN1MW gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			2	3		5
nonsense						0
start loss						0
frameshift	1					1
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	1	0	2	3	0

Variants in OPN1MW

This is a list of pathogenic ClinVar variants found in the OPN1MW region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-154187851-T-C		not specified	Benign/Likely benign (-)
X-154187917-C-T		not specified	Uncertain significance (Feb 22, 2024)
X-154187932-T-C		not specified	Uncertain significance (Jan 23, 2024)
X-154187939-C-A		Deuteranomaly	Pathogenic (Jun 07, 2002)
X-154187964-A-G			Likely benign (Feb 01, 2024)
X-154187988-G-A			Likely benign (-)
X-154187989-T-C		not specified	Uncertain significance (Apr 26, 2023)
X-154188004-A-C		not specified	Likely benign (Feb 16, 2023)
X-154190101-A-C			Likely benign (-)
X-154190109-C-G			Likely benign (-)
X-154190165-C-T		not specified	Likely benign (Jan 01, 2024)
X-154190173-T-C		Cone dystrophy 5, X-linked	Pathogenic (Jul 09, 2010)
X-154190176-A-G			Likely benign (Jan 01, 2024)
X-154190182-G-T		not specified	Benign (-)
X-154191716-T-C		Cone monochromatism • Deuteranopia	Pathogenic (Jan 01, 2009)
X-154193469-TGGTGGTGGTGATGGTCCTGGCATTCTGCTTCTGCTGGGGACCATACGCCTTCTTCGCATGCTTTGCTGCTGCCAACCCTGGCTACCCCTTCCACCCTTTGATGGCTGCCCTGCCGGCCTTCTTTGCCAAAAGTGCCACTATC-T		Achromatopsia	Pathogenic (Jun 18, 2021)
X-154193486-C-G		not specified	Uncertain significance (Sep 07, 2022)
X-154193498-T-G		not specified	Likely benign (Sep 23, 2023)
X-154193621-G-A		not specified	Likely benign (Jul 15, 2021)
X-154195934-G-A		Deuteranomaly	Pathogenic (Jun 07, 2002)
X-154195958-G-T			Uncertain significance (-)
X-154196003-C-T		not specified	Uncertain significance (Jul 22, 2022)

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Visual pigments are the light-absorbing molecules that mediate vision. They consist of an apoprotein, opsin, covalently linked to cis-retinal. {ECO:0000305|PubMed:12051694, ECO:0000305|PubMed:1302020, ECO:0000305|PubMed:2937147}.
• Disease: DISEASE: Colorblindness, partial, deutan series (CBD) [MIM:303800]: A color vision defect characterized by a dichromasy in which red and green are confused, without loss of luminance or shift or shortening of the spectrum. Dichromasy is due to the use of only two types of photoreceptors, blue plus red in deuteranopia and blue plus green in protanopia. {ECO:0000269|PubMed:12051694, ECO:0000269|PubMed:1302020}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Blue cone monochromacy (BCM) [MIM:303700]: A rare X- linked congenital stationary cone dysfunction syndrome characterized by the absence of functional long wavelength- sensitive and medium wavelength-sensitive cones in the retina. Color discrimination is severely impaired from birth, and vision is derived from the remaining preserved blue (S) cones and rod photoreceptors. BCM typically presents with reduced visual acuity, pendular nystagmus, and photophobia. Patients often have myopia. {ECO:0000269|PubMed:8666378}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Cone dystrophy 5 (COD5) [MIM:303700]: A X-linked cone dystrophy. Cone dystrophies are retinal dystrophies characterized by progressive degeneration of the cone photoreceptors with preservation of rod function, as indicated by electroretinogram. However, some rod involvement may be present in some cone dystrophies, particularly at late stage. Affected individuals suffer from photophobia, loss of visual acuity, color vision and central visual field. Another sign is the absence of macular lesions for many years. Cone dystrophies are distinguished from the cone-rod dystrophies in which some loss of peripheral vision also occurs. {ECO:0000269|PubMed:20579627}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: GPCRs, Class A Rhodopsin-like;Signaling by GPCR;Signal Transduction;Opsins;Class A/1 (Rhodopsin-like receptors);GPCR ligand binding;The retinoid cycle in cones (daylight vision);G alpha (i) signalling events;Visual phototransduction;GPCR downstream signalling (Consensus)

Recessive Scores

• pRec: 0.145

Haploinsufficiency Scores

• pHI: 0.103
• hipred: N
• hipred_score: 0.187

Essentials

• essential_gene_CRISPR: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.114

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Gene ontology

• Biological process: retinoid metabolic process;G protein-coupled receptor signaling pathway;visual perception;phototransduction;detection of visible light;protein-chromophore linkage;positive regulation of cytokinesis;cellular response to light stimulus
• Cellular component: photoreceptor outer segment;plasma membrane;integral component of plasma membrane;photoreceptor disc membrane
• Molecular function: G protein-coupled photoreceptor activity;photoreceptor activity;identical protein binding