PAK1
p21 (RAC1) activated kinase 1
Basic information
Region (hg38): 11:77322017-77474635
Links
Phenotypes
GenCC
Source:
- intellectual developmental disorder with macrocephaly, seizures, and speech delay (Moderate), mode of inheritance: AD
- intellectual developmental disorder with macrocephaly, seizures, and speech delay (Strong), mode of inheritance: AD
- neurodevelopmental disorder (Strong), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Intellectual developmental disorder with macrocephaly, seizures, and speech delay | AD | General | Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing | Craniofacial; Neurologic | 30290153 |
ClinVar
This is a list of variants' phenotypes submitted to
- PAK1-related disorder (1 variants)
- not provided (1 variants)
- Intellectual developmental disorder with macrocephaly, seizures, and speech delay (1 variants)
- PAK1-related neurodevelopmental disorders (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the PAK1 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 11 | |||||
| missense | 15 | 49 | 69 | |||
| nonsense | 1 | |||||
| start loss | 0 | |||||
| frameshift | 2 | |||||
| inframe indel | 1 | |||||
| splice donor/acceptor (+/-2bp) | 2 | |||||
| splice region | 2 | 1 | 1 | 4 | ||
| non coding | 3 | |||||
| Total | 2 | 15 | 58 | 11 | 3 |
Variants in PAK1
This is a list of pathogenic ClinVar variants found in the PAK1 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 11-77323283-G-C | not specified | Uncertain significance (Sep 26, 2024) | ||
| 11-77323326-C-G | Uncertain significance (Nov 28, 2023) | |||
| 11-77323331-G-A | Inborn genetic diseases | Uncertain significance (Sep 15, 2021) | ||
| 11-77323333-G-A | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Uncertain significance (May 18, 2020) | ||
| 11-77323355-T-C | Uncertain significance (Oct 01, 2022) | |||
| 11-77325367-G-T | Uncertain significance (Feb 01, 2023) | |||
| 11-77325370-T-A | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Uncertain significance (Jun 21, 2023) | ||
| 11-77332353-G-GGGGGGAGGGGAGGGGAGGGGAGGGGGGGAGGGTGGGGAAGGGGAGGGGAGGGGAGGGGGGAGGGGAGGGGGAAGGGGAGAGGGGAGGGGGGAGGGAGGGGGGAGGGGGAGGGGGAGGGGGAGGGGAGGGGGTAGGAGGAGGGGAAGGAAGGGAAGGATTGGAGGGGAAGCGAA | Schizophrenia | Uncertain significance (Nov 11, 2022) | ||
| 11-77332745-A-G | PAK1-related disorder | Likely benign (Jun 11, 2019) | ||
| 11-77332798-G-C | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Uncertain significance (Jan 06, 2020) | ||
| 11-77332854-A-G | Intellectual developmental disorder with macrocephaly, seizures, and speech delay • See cases | Pathogenic/Likely pathogenic (Nov 25, 2022) | ||
| 11-77332855-T-C | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Likely pathogenic (-) | ||
| 11-77332861-A-G | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Likely pathogenic (Aug 30, 2021) | ||
| 11-77336085-C-A | Uncertain significance (Jul 18, 2024) | |||
| 11-77336090-A-C | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Likely pathogenic (Nov 23, 2023) | ||
| 11-77336090-A-T | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Likely pathogenic (Jan 27, 2022) | ||
| 11-77336115-G-A | Uncertain significance (Nov 01, 2022) | |||
| 11-77336139-C-T | Uncertain significance (Jul 11, 2023) | |||
| 11-77336213-T-C | Intellectual developmental disorder with macrocephaly, seizures, and speech delay | Likely pathogenic (Feb 20, 2019) | ||
| 11-77336215-T-A | PAK1-related disorder | Likely benign (Jun 01, 2023) | ||
| 11-77336229-T-C | Uncertain significance (Jun 19, 2024) | |||
| 11-77336237-C-A | Uncertain significance (Jun 11, 2024) | |||
| 11-77336238-G-A | Inborn genetic diseases | Likely pathogenic (Jul 27, 2023) | ||
| 11-77336272-TC-T | PAK1-related disorder | Uncertain significance (Jan 05, 2024) | ||
| 11-77336274-C-T | Inborn genetic diseases | Uncertain significance (Jun 29, 2022) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| PAK1 | protein_coding | protein_coding | ENST00000278568 | 15 | 152929 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.00133 | 0.999 | 125735 | 0 | 13 | 125748 | 0.0000517 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 4.00 | 113 | 312 | 0.362 | 0.0000166 | 3635 |
| Missense in Polyphen | 30 | 138.54 | 0.21654 | 1612 | ||
| Synonymous | 0.241 | 108 | 111 | 0.971 | 0.00000580 | 1043 |
| Loss of Function | 3.48 | 11 | 32.4 | 0.340 | 0.00000175 | 377 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.000120 | 0.000120 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.000139 | 0.000139 |
| European (Non-Finnish) | 0.0000353 | 0.0000352 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.0000653 | 0.0000653 |
| Other | 0.000164 | 0.000163 |
dbNSFP
Source:
- Function
- FUNCTION: Protein kinase involved in intracellular signaling pathways downstream of integrins and receptor-type kinases that plays an important role in cytoskeleton dynamics, in cell adhesion, migration, proliferation, apoptosis, mitosis, and in vesicle-mediated transport processes. Can directly phosphorylate BAD and protects cells against apoptosis. Activated by interaction with CDC42 and RAC1. Functions as GTPase effector that links the Rho-related GTPases CDC42 and RAC1 to the JNK MAP kinase pathway. Phosphorylates and activates MAP2K1, and thereby mediates activation of downstream MAP kinases. Involved in the reorganization of the actin cytoskeleton, actin stress fibers and of focal adhesion complexes. Phosphorylates the tubulin chaperone TBCB and thereby plays a role in the regulation of microtubule biogenesis and organization of the tubulin cytoskeleton. Plays a role in the regulation of insulin secretion in response to elevated glucose levels. Part of a ternary complex that contains PAK1, DVL1 and MUSK that is important for MUSK-dependent regulation of AChR clustering during the formation of the neuromuscular junction (NMJ). Activity is inhibited in cells undergoing apoptosis, potentially due to binding of CDC2L1 and CDC2L2. Phosphorylates MYL9/MLC2. Phosphorylates RAF1 at 'Ser-338' and 'Ser-339' resulting in: activation of RAF1, stimulation of RAF1 translocation to mitochondria, phosphorylation of BAD by RAF1, and RAF1 binding to BCL2. Phosphorylates SNAI1 at 'Ser-246' promoting its transcriptional repressor activity by increasing its accumulation in the nucleus. In podocytes, promotes NR3C2 nuclear localization. Required for atypical chemokine receptor ACKR2- induced phosphorylation of LIMK1 and cofilin (CFL1) and for the up-regulation of ACKR2 from endosomal compartment to cell membrane, increasing its efficiency in chemokine uptake and degradation. In synapses, seems to mediate the regulation of F- actin cluster formation performed by SHANK3, maybe through CFL1 phosphorylation and inactivation. Plays a role in RUFY3-mediated facilitating gastric cancer cells migration and invasion (PubMed:25766321). {ECO:0000269|PubMed:10551809, ECO:0000269|PubMed:11733498, ECO:0000269|PubMed:12624090, ECO:0000269|PubMed:12876277, ECO:0000269|PubMed:14585966, ECO:0000269|PubMed:15611088, ECO:0000269|PubMed:15831477, ECO:0000269|PubMed:15833848, ECO:0000269|PubMed:16278681, ECO:0000269|PubMed:17726028, ECO:0000269|PubMed:17989089, ECO:0000269|PubMed:22669945, ECO:0000269|PubMed:23633677, ECO:0000269|PubMed:25766321, ECO:0000269|PubMed:8805275, ECO:0000269|PubMed:9032240, ECO:0000269|PubMed:9395435, ECO:0000269|PubMed:9528787}.;
- Pathway
- Focal adhesion - Homo sapiens (human);T cell receptor signaling pathway - Homo sapiens (human);Fc gamma R-mediated phagocytosis - Homo sapiens (human);Renal cell carcinoma - Homo sapiens (human);ErbB signaling pathway - Homo sapiens (human);Chemokine signaling pathway - Homo sapiens (human);Regulation of actin cytoskeleton - Homo sapiens (human);Epithelial cell signaling in Helicobacter pylori infection - Homo sapiens (human);Axon guidance - Homo sapiens (human);Hippo signaling pathway - multiple species - Homo sapiens (human);cAMP signaling pathway - Homo sapiens (human);C-type lectin receptor signaling pathway - Homo sapiens (human);Ras signaling pathway - Homo sapiens (human);MAPK signaling pathway - Homo sapiens (human);Natural killer cell mediated cytotoxicity - Homo sapiens (human);Proteoglycans in cancer - Homo sapiens (human);Intracellular Signalling Through Adenosine Receptor A2b and Adenosine;Intracellular Signalling Through Adenosine Receptor A2a and Adenosine;EGF-Core;Angiogenesis overview;Integrin-mediated Cell Adhesion;Prolactin Signaling Pathway;Regulation of Microtubule Cytoskeleton;Androgen Receptor Network in Prostate Cancer;Integrated Lung Cancer Pathway;JAK-STAT;Focal Adhesion;Signaling of Hepatocyte Growth Factor Receptor;Fas Ligand (FasL) pathway and Stress induction of Heat Shock Proteins (HSP) regulation;Rac1-Pak1-p38-MMP-2 pathway;Association Between Physico-Chemical Features and Toxicity Associated Pathways;MAPK Signaling Pathway;T-Cell antigen Receptor (TCR) pathway during Staphylococcus aureus infection;VEGFA-VEGFR2 Signaling Pathway;Chemokine signaling pathway;Ebola Virus Pathway on Host;MET in type 1 papillary renal cell carcinoma;Ebola Virus Pathway on Host;Ras Signaling;EMT transition in Colorectal Cancer;EGF-EGFR Signaling Pathway;Regulation of Actin Cytoskeleton;T-Cell antigen Receptor (TCR) Signaling Pathway;Developmental Biology;Smooth Muscle Contraction;Signal Transduction;DSCAM interactions;links between pyk2 and map kinases;role of pi3k subunit p85 in regulation of actin organization and cell migration;influence of ras and rho proteins on g1 to s transition;angiotensin ii mediated activation of jnk pathway via pyk2 dependent signaling;VEGFA-VEGFR2 Pathway;ras-independent pathway in nk cell-mediated cytotoxicity;rac1 cell motility signaling pathway;mapkinase signaling pathway;Prolactin;Alpha6Beta4Integrin;Generation of second messenger molecules;MAPK6/MAPK4 signaling;TCR signaling;CD28 dependent Vav1 pathway;CD28 co-stimulation;Costimulation by the CD28 family;CD209 (DC-SIGN) signaling;C-type lectin receptors (CLRs);Fcgamma receptor (FCGR) dependent phagocytosis;EPH-Ephrin signaling;FCERI mediated MAPK activation;Fc epsilon receptor (FCERI) signaling;TCR;Innate Immune System;Immune System;EPHB-mediated forward signaling;Ephrin signaling;Adaptive Immune System;Activation of RAC1;RHO GTPases Activate ROCKs;fas signaling pathway (cd95);RHO GTPases activate PAKs;Aurora A signaling;RHO GTPases activate PKNs;Muscle contraction;IL-7 signaling;RHO GTPase Effectors;Signaling by Rho GTPases;EGFR1;agrin in postsynaptic differentiation;CXCR4-mediated signaling events;Sema3A PAK dependent Axon repulsion;fmlp induced chemokine gene expression in hmc-1 cells;MAPK family signaling cascades;Semaphorin interactions;JAK STAT pathway and regulation;PDGF;Regulation of actin dynamics for phagocytic cup formation;EPO signaling;Netrin-1 signaling;Signal transduction by L1;Signaling by ROBO receptors;Signaling by VEGF;L1CAM interactions;Angiopoietin receptor Tie2-mediated signaling;Axon guidance;TNFalpha;Signaling by Receptor Tyrosine Kinases;VEGF;RAC1 signaling pathway;CDC42 signaling events;Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met);Netrin-mediated signaling events;Signaling events mediated by focal adhesion kinase;PLK1 signaling events;Regulation of p38-alpha and p38-beta;EPHB forward signaling;PDGFR-beta signaling pathway;EPHA2 forward signaling;S1P2 pathway;VEGFR2 mediated vascular permeability
(Consensus)
Recessive Scores
- pRec
- 0.346
Intolerance Scores
- loftool
- 0.494
- rvis_EVS
- -0.6
- rvis_percentile_EVS
- 17.75
Haploinsufficiency Scores
- pHI
- 0.928
- hipred
- Y
- hipred_score
- 0.756
- ghis
- 0.650
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.999
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Pak1
- Phenotype
- growth/size/body region phenotype; cellular phenotype; homeostasis/metabolism phenotype; muscle phenotype; normal phenotype; hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); respiratory system phenotype; immune system phenotype; skeleton phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan);
Zebrafish Information Network
- Gene name
- pak1
- Affected structure
- melanocyte
- Phenotype tag
- abnormal
- Phenotype quality
- decreased amount
Gene ontology
- Biological process
- MAPK cascade;response to hypoxia;positive regulation of protein phosphorylation;stimulatory C-type lectin receptor signaling pathway;protein phosphorylation;exocytosis;apoptotic process;positive regulation of cell population proliferation;positive regulation of fibroblast migration;cell migration;cerebellum development;signal transduction by protein phosphorylation;establishment of cell polarity;positive regulation of cell migration;stress-activated protein kinase signaling cascade;positive regulation of microtubule polymerization;T cell costimulation;actin cytoskeleton reorganization;activation of protein kinase activity;cellular response to insulin stimulus;positive regulation of peptidyl-serine phosphorylation;positive regulation of intracellular estrogen receptor signaling pathway;Fc-epsilon receptor signaling pathway;Fc-gamma receptor signaling pathway involved in phagocytosis;wound healing;regulation of MAPK cascade;positive regulation of JUN kinase activity;positive regulation of axon extension;positive regulation of insulin receptor signaling pathway;protein autophosphorylation;hepatocyte growth factor receptor signaling pathway;ephrin receptor signaling pathway;branching morphogenesis of an epithelial tube;neuron projection morphogenesis;regulation of axonogenesis;T cell receptor signaling pathway;positive regulation of stress fiber assembly;negative regulation of cell proliferation involved in contact inhibition;negative regulation of cell growth involved in cardiac muscle cell development;positive regulation of protein targeting to membrane;positive regulation of vascular smooth muscle cell proliferation;positive regulation of vascular associated smooth muscle cell migration
- Cellular component
- ruffle;cytoplasm;cytosol;actin filament;plasma membrane;cell-cell junction;focal adhesion;intercalated disc;Z disc;lamellipodium;axon;dendrite;nuclear membrane;ruffle membrane;protein-containing complex;invadopodium
- Molecular function
- protein kinase activity;protein serine/threonine kinase activity;protein binding;collagen binding;ATP binding;protein kinase binding;Rac GTPase binding