PERM1

PPARGC1 and ESRR induced regulator, muscle 1

Basic information

Region (hg38): 1:975198-982117

Previous symbols: [ "C1orf170" ]

Links

ENSG00000187642 ∙ NCBI:84808 ∙ OMIM:615921 ∙ HGNC:28208 ∙ Uniprot:Q5SV97 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the PERM1 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the PERM1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				5		5
missense				1		1
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding				1		1
Total	0	0	0	7	0

Variants in PERM1

This is a list of pathogenic ClinVar variants found in the PERM1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
1-976215-A-G		Neutrophil inclusion bodies • Renal tubular epithelial cell apoptosis	Pathogenic (-)
1-976611-CCCCCGGAGCTCCCCTAGGACAGAAGCTCACCTTCAGCCCCACGGCTGCACTCAGAGATGGCCCCGCACACGCCCGCCCCGGGAACCGCCTGCCCCCACCCCCACCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCGCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCACCACCCCGCCAACCCCGGGAACCGCCTGCCCCCACCGACCAACCCCGGGAACCGCCTCCCACTCCCCCCGCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCACCAACCCCGGGAACCGCCTCCCGCTCCCCCCGCAACCCCGGGAACCGCCTGCCCCCACCGACCAACCCCGGGAACCGCCTCCCACCCCCACCAACCCCGGGAACCGCCTCCCAATCCCCCCAACCCCGGGAACTGCCTCCCACCCCCACCAA-C		Congenital myasthenic syndrome 8	Pathogenic (Feb 22, 2024)
1-978918-G-A			Likely benign (Dec 01, 2022)
1-979038-G-A			Likely benign (May 01, 2022)
1-979313-C-T			Likely benign (Apr 01, 2024)
1-979668-G-A			Likely benign (Jul 01, 2023)
1-980025-A-G			Likely benign (Feb 01, 2025)
1-980289-G-A			Likely benign (Oct 01, 2024)
1-980388-A-G			Likely benign (Dec 01, 2022)
1-981131-C-T			Likely benign (Apr 01, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
PERM1	protein_coding	protein_coding	ENST00000433179	5	6919

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.17e-15	0.00298	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.555	422	391	1.08	0.0000242	4345
Missense in Polyphen		110	97.787	1.1249		1182
Synonymous	-2.39	215	175	1.23	0.0000122	1611
Loss of Function	-0.713	21	17.8	1.18	0.00000103	204

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Regulates the expression of selective PPARGC1A/B and ESRRA/B/G target genes with roles in glucose and lipid metabolism, energy transfer, contractile function, muscle mitochondrial biogenesis and oxidative capacity. Required for the efficient induction of MT-CO2, MT-CO3, COX4I1, TFB1M, TFB2M, POLRMT and SIRT3 by PPARGC1A. Positively regulates the PPARGC1A/ESRRG-induced expression of CKMT2, TNNI3 and SLC2A4 and negatively regulates the PPARGC1A/ESRRG-induced expression of PDK4. {ECO:0000250|UniProtKB:Q149B8}.
• Pathway: Mitochondrial biogenesis (Consensus)

Haploinsufficiency Scores

• pHI: 0.0670
• ghis: 0.552

Mouse Genome Informatics

• Gene name: Perm1

Gene ontology

• Biological process: regulation of transcription, DNA-templated;response to muscle activity
• Cellular component: nucleus;cytoplasm