PEX16

peroxisomal biogenesis factor 16, the group of Peroxins

Basic information

Region (hg38): 11:45909662-45918812

Links

ENSG00000121680 ∙ NCBI:9409 ∙ OMIM:603360 ∙ HGNC:8857 ∙ Uniprot:Q9Y5Y5 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• peroxisome biogenesis disorder 8A (Zellweger) (Definitive), mode of inheritance: AR
• Zellweger spectrum disorders (Supportive), mode of inheritance: AR
• peroxisome biogenesis disorder 8B (Definitive), mode of inheritance: AR
• peroxisome biogenesis disorder 8B (Strong), mode of inheritance: AR
• peroxisome biogenesis disorder (Definitive), mode of inheritance: AR
• peroxisome biogenesis disorder 8B (Moderate), mode of inheritance: AR
• peroxisome biogenesis disorder 8A (Zellweger) (Moderate), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Peroxisome biogenesis factor disorder 8A (Zellweger syndrome); Peroxisome biogenesis disorder 8B	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Biochemical; Craniofacial; Gastrointestinal; Genitourinary; Musculoskeletal; Neurologic; Renal	9837814; 11890679; 20647552

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the PEX16 gene.

• Peroxisome biogenesis disorder (420 variants)
• not provided (75 variants)
• Peroxisome biogenesis disorder 8A (Zellweger) (52 variants)
• Inborn genetic diseases (19 variants)
• not specified (9 variants)
• PEX16-related condition (8 variants)
• Peroxisome biogenesis disorder 8B (7 variants)
• Peroxisome biogenesis disorder 1A (Zellweger) (4 variants)
• Peroxisome biogenesis disorder 8A (Zellweger);Peroxisome biogenesis disorder 8B (4 variants)
• Peroxisome biogenesis disorder 8B;Peroxisome biogenesis disorder 8A (Zellweger) (2 variants)
• Methylmalonic aciduria due to methylmalonyl-CoA mutase deficiency (1 variants)
• Microcephaly (1 variants)
• Peroxisome biogenesis disorder due to PEX16 defect (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the PEX16 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	96	3	105
missense		3	160	5	1	169
nonsense	10					10
start loss						0
frameshift	2		1			3
inframe indel		1	3			4
splice donor/acceptor (+/-2bp)		8				8
splice region			17	21	1	39
non coding			14	84	15	113
Total	12	12	184	185	19

Highest pathogenic variant AF is 0.0000131

Variants in PEX16

This is a list of pathogenic ClinVar variants found in the PEX16 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
11-45909667-T-C		Peroxisome biogenesis disorder 1A (Zellweger)	Likely benign (Jun 14, 2016)
11-45909697-C-G		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45909763-C-T		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45909816-G-A		Peroxisome biogenesis disorder 8A (Zellweger)	Benign (Apr 20, 2019)
11-45909878-C-G		Peroxisome biogenesis disorder 8A (Zellweger)	Benign (Apr 21, 2021)
11-45909878-C-T		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 12, 2018)
11-45909913-G-A		Peroxisome biogenesis disorder 1A (Zellweger)	Uncertain significance (Jun 14, 2016)
11-45909930-C-T		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45909945-C-G		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45909951-G-A		Peroxisome biogenesis disorder 8A (Zellweger)	Benign (Aug 07, 2018)
11-45909977-G-A		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45910079-G-T		Peroxisome biogenesis disorder 8A (Zellweger) • PEX16-related disorder	Conflicting classifications of pathogenicity (Aug 29, 2019)
11-45910084-C-T		PEX16-related disorder	Likely benign (Feb 20, 2024)
11-45910095-G-A			Likely benign (Jun 01, 2023)
11-45910096-T-G		Peroxisome biogenesis disorder 8A (Zellweger)	Benign/Likely benign (Nov 18, 2020)
11-45910131-T-C		PEX16-related disorder	Likely benign (Nov 22, 2021)
11-45910147-G-A		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 13, 2018)
11-45910171-TGGGACGCTGCCGGAGTCAGTTTTATTAGGGAAGAGGGGCTCCCTGCCCCACCCCTCCCCACACCCTCCTTCCGGGAGGTCTGTCAGCCCCAACTGTAGAAGTAGATTTTCTGCCAGGTGGGCAAGTAATCCATGAGCGGCCCTGCAGTGGGAGAGGGACACATCAGGGCAGGCCAGACCCCAATCTGCACTGTGGCGCCACATACAGCACCTCACCCCTGCGGCCCAGGAGCCAGCCCAGCTGGCTGTCTTGCCCTGCCCCCAGGAGGCAGCACTGCAGGGGACTCTGGCACCATTTACAAAGACCCTCAGGCCCAGAGAAGCTCAGCCAGGGTAGACACTGAGGGGCCTGAGTCAGGTCCAGTCACCCAACCCAAGCCCAGTGGGCCTCTGCTGAGGGAGGATCTCAGCAGCCCGGTGGACCCCTTCTCTGCCATTGAATCCCCCCAAGATGAGATGGTCCCGTATCGCTCCAGGATACTGTGACCAGAAAAAAGCTGGCAGCTGATGTGGTCCCCCCACCAGTGGACACCCTCCTTCCAGCCATCCCTGGCTCCTCAGGCCACCCTGGCCTATGCCCAGGGGCAGTCCCACCCAATCCTGACTTCCC-T		Peroxisome biogenesis disorder 8B	Pathogenic (Sep 01, 2010)
11-45910176-C-T		PEX16-related disorder	Likely benign (Dec 29, 2021)
11-45910184-G-C		Peroxisome biogenesis disorder 8A (Zellweger) • PEX16-related disorder	Conflicting classifications of pathogenicity (Jun 19, 2019)
11-45910189-A-G		Peroxisome biogenesis disorder 8A (Zellweger) • Peroxisome biogenesis disorder 8B;Peroxisome biogenesis disorder 8A (Zellweger)	Likely benign (Oct 08, 2021)
11-45910201-G-C		Peroxisome biogenesis disorder 8A (Zellweger)	Uncertain significance (Jan 12, 2018)
11-45910244-G-A		not specified • Peroxisome biogenesis disorder 8A (Zellweger)	Benign/Likely benign (Jan 12, 2018)
11-45910253-G-A		PEX16-related disorder	Likely benign (Oct 20, 2023)
11-45910259-C-G		Peroxisome biogenesis disorder	Uncertain significance (Aug 15, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
PEX16	protein_coding	protein_coding	ENST00000241041	11	9144

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0000829	0.985	125728	0	20	125748	0.0000795

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.452	195	214	0.913	0.0000150	2132
Missense in Polyphen		53	70.738	0.74925		680
Synonymous	-0.121	95	93.5	1.02	0.00000607	765
Loss of Function	2.16	10	20.6	0.486	9.89e-7	219

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000213	0.000210
Ashkenazi Jewish	0.00	0.00
East Asian	0.000163	0.000163
Finnish	0.0000543	0.0000462
European (Non-Finnish)	0.0000444	0.0000439
Middle Eastern	0.000163	0.000163
South Asian	0.000163	0.000163
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Required for peroxisome membrane biogenesis. May play a role in early stages of peroxisome assembly. Can recruit other peroxisomal proteins, such as PEX3 and PMP34, to de novo peroxisomes derived from the endoplasmic reticulum (ER). May function as receptor for PEX3. {ECO:0000269|PubMed:10704444, ECO:0000269|PubMed:12223482, ECO:0000269|PubMed:16717127}.
• Disease: DISEASE: Peroxisome biogenesis disorder complementation group 9 (PBD-CG9) [MIM:614876]: A peroxisomal disorder arising from a failure of protein import into the peroxisomal membrane or matrix. The peroxisome biogenesis disorders (PBD group) are genetically heterogeneous with at least 14 distinct genetic groups as concluded from complementation studies. Include disorders are: Zellweger syndrome (ZWS), neonatal adrenoleukodystrophy (NALD), infantile Refsum disease (IRD), and classical rhizomelic chondrodysplasia punctata (RCDP). ZWS, NALD and IRD are distinct from RCDP and constitute a clinical continuum of overlapping phenotypes known as the Zellweger spectrum (PBD-ZSS). {ECO:0000269|PubMed:9837814}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Peroxisome biogenesis disorder 8A (PBD8A) [MIM:614876]: A fatal peroxisome biogenesis disorder belonging to the Zellweger disease spectrum and clinically characterized by severe neurologic dysfunction with profound psychomotor retardation, severe hypotonia and neonatal seizures, craniofacial abnormalities, liver dysfunction, and biochemically by the absence of peroxisomes. Additional features include cardiovascular and skeletal defects, renal cysts, ocular abnormalities, and hearing impairment. Most severely affected individuals with the classic form of the disease (classic Zellweger syndrome) die within the first year of life. {ECO:0000269|PubMed:9837814}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Peroxisome biogenesis disorder 8B (PBD8B) [MIM:614877]: A relatively mild peroxisome biogenesis disorder. Affected individuals manifest lower limb spasticity and ataxia resulting in wheelchair dependence. Other features include optic atrophy, cataracts, dysarthria, dysphagia, constipation, and a peripheral demyelinating motor and sensory neuropathy. Cognition is relatively preserved. Biochemical abnormalities are mild and include increased very-long-chain fatty acids (VLCFA), increased bile acid intermediates, and increased branched chain fatty acids. Phytanic acid alpha-oxidation, pristanic acid beta-oxidation, and red cell plasmalogen are normal. {ECO:0000269|PubMed:20647552}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Peroxisome - Homo sapiens (human) (Consensus)

Recessive Scores

• pRec: 0.194

Intolerance Scores

• loftool: 0.678
• rvis_EVS: 0.26
• rvis_percentile_EVS: 70.44

Haploinsufficiency Scores

• pHI: 0.0769
• hipred: N
• hipred_score: 0.331
• ghis: 0.404

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: E
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.719

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Pex16

Gene ontology

• Biological process: protein targeting to peroxisome;peroxisome organization;peroxisome membrane biogenesis;protein import into peroxisome matrix;protein to membrane docking;ER-dependent peroxisome organization;protein import into peroxisome membrane;ER-dependent peroxisome localization
• Cellular component: peroxisome;peroxisomal membrane;integral component of peroxisomal membrane;endoplasmic reticulum;endoplasmic reticulum membrane;membrane
• Molecular function: protein binding;protein C-terminus binding