PLXNB2

plexin B2, the group of Plexins|IPT domain containing

Basic information

Region (hg38): 22:50274979-50307646

Links

ENSG00000196576 ∙ NCBI:23654 ∙ OMIM:604293 ∙ HGNC:9104 ∙ Uniprot:O15031 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the PLXNB2 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the PLXNB2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				7	6	13
missense			170	13	1	184
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region				1	1	2
non coding					1	1
Total	0	0	170	20	8

Variants in PLXNB2

This is a list of pathogenic ClinVar variants found in the PLXNB2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
22-50275723-T-G		not specified	Uncertain significance (Feb 06, 2023)
22-50275891-C-T			Likely benign (Apr 01, 2023)
22-50275960-G-A		not specified	Uncertain significance (Aug 20, 2024)
22-50275962-G-A		not specified	Uncertain significance (Mar 29, 2023)
22-50276631-G-A		not specified	Uncertain significance (Aug 14, 2024)
22-50276655-TCATGTCCTGGTCGCTGACCTGCACCATCTGCCGGATCCCCTTGTAGTAACTGCAGGGGTGGGAGCATCATACAGTGTGGGCGGCAGGGACCACAAAGGGGGTGGTGGGGGAAACCAAGGCCTGAACCTCCCCGCAGGGGGTCGAGGGTGGGCATGGGGGCCTGGCCTGGAGGGCAGGCAGACTTACTCCTCCACCATCTTCTTGTAGGTGGAGATCTCCTTGGCGTACAGCAGCTTGTTGCTGGGAGAATCCTGTTGGGGACAAAACCCAGTGATGCCTGGCCAAGGGGGCCAGGCTGGGGCTGCTCAGAGTACCCCTGGGTAGCTTCCCCTGCCCCGAACTCCTGACACTTTCATCAAGAAAACTATGGGCCGGGCGCAGTGGCTCAGGCCTGTAATCCTAGCACTTTGGGAGGCTGAGGCAGGCAGATCACCTGAGGTCAGGGGTTCGAGACCAGCCTGCCCAACATGGTGAAACCCCGTCTCTACTAAAAATACTAGCCGTGCGTTGTGGCACATGCCTGTAGTCCCAGCTACTCAGGAGGCAGCGGCGGGAAAATCGCTTGAACCTAGAAGGCGGAGGTTGCAG-T		See cases	Pathogenic (Jan 04, 2023)
22-50276696-T-C		not specified	Uncertain significance (Dec 31, 2024)
22-50277610-G-A		not specified	Uncertain significance (Nov 15, 2023)
22-50277616-G-A		not specified	Uncertain significance (Jan 21, 2025)
22-50277733-G-A		not specified	Uncertain significance (Dec 02, 2022)
22-50277944-C-A		not specified	Uncertain significance (Aug 16, 2022)
22-50277946-G-A		not specified	Uncertain significance (May 31, 2023)
22-50277956-C-T		not specified	Uncertain significance (Mar 31, 2022)
22-50278157-G-A		not specified	Uncertain significance (Sep 22, 2023)
22-50278219-G-A			Likely benign (Jan 01, 2025)
22-50278474-G-C		not specified	Uncertain significance (Feb 12, 2025)
22-50278513-C-T		not specified	Uncertain significance (Dec 12, 2024)
22-50278634-C-T		See cases	Pathogenic (Jan 04, 2023)
22-50278640-G-A		not specified	Uncertain significance (Jul 19, 2022)
22-50278663-G-A		not specified	Uncertain significance (Feb 21, 2024)
22-50278700-T-G			Benign (Apr 16, 2022)
22-50278864-C-T		not specified	Uncertain significance (Sep 23, 2023)
22-50278968-G-A		not specified	Uncertain significance (Nov 30, 2021)
22-50278976-G-A			Likely benign (Mar 01, 2025)
22-50278995-A-T			Uncertain significance (Oct 21, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
PLXNB2	protein_coding	protein_coding	ENST00000449103	35	32649

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.992	0.00766	124857	0	28	124885	0.000112

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.36	896	1.23e+3	0.730	0.0000882	11907
Missense in Polyphen		276	546.14	0.50537		5638
Synonymous	-3.17	675	578	1.17	0.0000475	3710
Loss of Function	7.10	17	89.5	0.190	0.00000470	944

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000233	0.000233
Ashkenazi Jewish	0.000301	0.000298
East Asian	0.0000590	0.0000556
Finnish	0.000287	0.000278
European (Non-Finnish)	0.0000357	0.0000353
Middle Eastern	0.0000590	0.0000556
South Asian	0.000164	0.000163
Other	0.000166	0.000165

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Cell surface receptor for SEMA4C, SEMA4D and SEMA4G that plays an important role in cell-cell signaling. Binding to class 4 semaphorins promotes downstream activation of RHOA and phosphorylation of ERBB2 at 'Tyr-1248'. Required for normal differentiation and migration of neuronal cells during brain corticogenesis and for normal embryonic brain development. Regulates the migration of cerebellar granule cells in the developing brain. Plays a role in RHOA activation and subsequent changes of the actin cytoskeleton. Plays a role in axon guidance, invasive growth and cell migration. May modulate the activity of RAC1 and CDC42. Down-regulates macrophage migration in wound- healing assays (in vitro) (By similarity). {ECO:0000250, ECO:0000269|PubMed:12183458, ECO:0000269|PubMed:12533544, ECO:0000269|PubMed:15184888}.
• Pathway: Axon guidance - Homo sapiens (human) (Consensus)

Recessive Scores

• pRec: 0.124

Intolerance Scores

• loftool: 0.335
• rvis_EVS: -3.3
• rvis_percentile_EVS: 0.42

Haploinsufficiency Scores

• pHI: 0.219
• hipred: Y
• hipred_score: 0.706
• ghis: 0.597

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.665

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Plxnb2
• Phenotype: nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); limbs/digits/tail phenotype; renal/urinary system phenotype; embryo phenotype; pigmentation phenotype; reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; cellular phenotype; homeostasis/metabolism phenotype

Zebrafish Information Network

• Gene name: plxnb2a
• Affected structure: axial vasculature
• Phenotype tag: abnormal
• Phenotype quality: has fewer parts of type

Gene ontology

• Biological process: neural tube closure;regulation of protein phosphorylation;homophilic cell adhesion via plasma membrane adhesion molecules;negative regulation of cell adhesion;neuroblast proliferation;brain development;regulation of cell shape;positive regulation of neuron projection development;regulation of cell migration;regulation of GTPase activity;positive regulation of axonogenesis;semaphorin-plexin signaling pathway;semaphorin-plexin signaling pathway involved in axon guidance;regulation of neuron migration
• Cellular component: semaphorin receptor complex;integral component of plasma membrane;cell surface;extracellular exosome
• Molecular function: protein binding;semaphorin receptor activity