PRKCG
protein kinase C gamma, the group of C2 domain containing protein kinases
Basic information
Region (hg38): 19:53879190-53907652
Previous symbols: [ "PKCG", "SCA14" ]
Links
Phenotypes
GenCC
Source:
- spinocerebellar ataxia type 14 (Definitive), mode of inheritance: AD
- spinocerebellar ataxia type 14 (Strong), mode of inheritance: AD
- spinocerebellar ataxia type 14 (Supportive), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Spinocerebellar ataxia 14 | AD/AR | General | Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing | Neurologic | 10939565; 12164726; 12644968; 14694043; 14676051; 16193476; 15841389; 19561170; 21434874; 21827914; 21937992; 22675081; 23604456 |
| Homozygosity has been described in severe cases |
ClinVar
This is a list of variants' phenotypes submitted to
- Spinocerebellar ataxia type 14 (5 variants)
- not provided (3 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the PRKCG gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 17 | 33 | ||||
| missense | 16 | 102 | 127 | |||
| nonsense | 2 | |||||
| start loss | 1 | |||||
| frameshift | 2 | |||||
| inframe indel | 3 | |||||
| splice donor/acceptor (+/-2bp) | 0 | |||||
| splice region | 4 | 2 | 2 | 8 | ||
| non coding | 16 | 24 | 40 | 80 | ||
| Total | 5 | 16 | 133 | 43 | 51 |
Variants in PRKCG
This is a list of pathogenic ClinVar variants found in the PRKCG region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 19-53880584-C-CATTCATAGAGCCAGAGACACAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACAAAGAGAGATTCAGAGTCAGAGAAACATAGAG | Uncertain significance (-) | |||
| 19-53882183-A-C | Benign (Sep 25, 2019) | |||
| 19-53882262-C-T | Spinocerebellar ataxia type 14 | Uncertain significance (Jan 12, 2018) | ||
| 19-53882302-TGGCGGAGCCGGCGCG-T | Likely benign (Feb 09, 2022) | |||
| 19-53882326-G-C | Autosomal dominant cerebellar ataxia | Uncertain significance (Jun 14, 2016) | ||
| 19-53882483-G-T | not specified | Uncertain significance (Dec 15, 2023) | ||
| 19-53882495-A-G | Uncertain significance (Nov 01, 2017) | |||
| 19-53882502-G-A | Uncertain significance (Nov 03, 2022) | |||
| 19-53882535-G-A | Inborn genetic diseases | Uncertain significance (Feb 15, 2023) | ||
| 19-53882535-G-GA | Uncertain significance (Nov 02, 2023) | |||
| 19-53882541-G-A | Inborn genetic diseases | Uncertain significance (Dec 19, 2023) | ||
| 19-53882562-G-A | Uncertain significance (Sep 03, 2020) | |||
| 19-53882564-GCC-CCT | Uncertain significance (Jun 14, 2023) | |||
| 19-53882566-C-T | not specified • Spinocerebellar ataxia type 14 | Benign (Oct 25, 2021) | ||
| 19-53882570-A-G | Spinocerebellar ataxia type 14 | not provided (-) | ||
| 19-53882571-G-A | Uncertain significance (Aug 07, 2017) | |||
| 19-53882593-C-G | Uncertain significance (Jan 31, 2022) | |||
| 19-53882601-A-G | Spinocerebellar ataxia type 14 | Pathogenic (Jul 22, 2021) | ||
| 19-53882608-C-T | Uncertain significance (Aug 19, 2022) | |||
| 19-53882616-G-C | Spinocerebellar ataxia type 14 | Likely pathogenic (Aug 03, 2023) | ||
| 19-53882637-T-C | Uncertain significance (Sep 10, 2021) | |||
| 19-53882648-T-A | Spinocerebellar ataxia type 14 | Likely pathogenic (Mar 30, 2015) | ||
| 19-53882648-T-C | Uncertain significance (Apr 26, 2022) | |||
| 19-53882649-G-T | Uncertain significance (Jan 20, 2022) | |||
| 19-53882673-A-T | PRKCG-related disorder | Likely benign (Apr 03, 2020) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| PRKCG | protein_coding | protein_coding | ENST00000263431 | 18 | 28463 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 1.00 | 0.000153 | 125743 | 0 | 5 | 125748 | 0.0000199 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 3.06 | 238 | 413 | 0.576 | 0.0000250 | 4568 |
| Missense in Polyphen | 48 | 149.11 | 0.32191 | 1738 | ||
| Synonymous | -0.337 | 174 | 168 | 1.03 | 0.0000110 | 1362 |
| Loss of Function | 5.28 | 3 | 38.3 | 0.0784 | 0.00000207 | 408 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.0000578 | 0.0000578 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000264 | 0.0000264 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.00 | 0.00 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Calcium-activated, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that plays diverse roles in neuronal cells and eye tissues, such as regulation of the neuronal receptors GRIA4/GLUR4 and GRIN1/NMDAR1, modulation of receptors and neuronal functions related to sensitivity to opiates, pain and alcohol, mediation of synaptic function and cell survival after ischemia, and inhibition of gap junction activity after oxidative stress. Binds and phosphorylates GRIA4/GLUR4 glutamate receptor and regulates its function by increasing plasma membrane-associated GRIA4 expression. In primary cerebellar neurons treated with the agonist 3,5-dihyidroxyphenylglycine, functions downstream of the metabotropic glutamate receptor GRM5/MGLUR5 and phosphorylates GRIN1/NMDAR1 receptor which plays a key role in synaptic plasticity, synaptogenesis, excitotoxicity, memory acquisition and learning. May be involved in the regulation of hippocampal long-term potentiation (LTP), but may be not necessary for the process of synaptic plasticity. May be involved in desensitization of mu-type opioid receptor-mediated G-protein activation in the spinal cord, and may be critical for the development and/or maintenance of morphine-induced reinforcing effects in the limbic forebrain. May modulate the functionality of mu-type-opioid receptors by participating in a signaling pathway which leads to the phosphorylation and degradation of opioid receptors. May also contributes to chronic morphine-induced changes in nociceptive processing. Plays a role in neuropathic pain mechanisms and contributes to the maintenance of the allodynia pain produced by peripheral inflammation. Plays an important role in initial sensitivity and tolerance to ethanol, by mediating the behavioral effects of ethanol as well as the effects of this drug on the GABA(A) receptors. During and after cerebral ischemia modulate neurotransmission and cell survival in synaptic membranes, and is involved in insulin-induced inhibition of necrosis, an important mechanism for minimizing ischemic injury. Required for the elimination of multiple climbing fibers during innervation of Purkinje cells in developing cerebellum. Is activated in lens epithelial cells upon hydrogen peroxide treatment, and phosphorylates connexin-43 (GJA1/CX43), resulting in disassembly of GJA1 gap junction plaques and inhibition of gap junction activity which could provide a protective effect against oxidative stress (By similarity). Phosphorylates p53/TP53 and promotes p53/TP53-dependent apoptosis in response to DNA damage. Involved in the phase resetting of the cerebral cortex circadian clock during temporally restricted feeding. Stabilizes the core clock component ARNTL/BMAL1 by interfering with its ubiquitination, thus suppressing its degradation, resulting in phase resetting of the cerebral cortex clock (By similarity). {ECO:0000250|UniProtKB:P63318, ECO:0000250|UniProtKB:P63319, ECO:0000269|PubMed:16377624}.;
- Disease
- DISEASE: Spinocerebellar ataxia 14 (SCA14) [MIM:605361]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA14 is an autosomal dominant cerebellar ataxia (ADCA). {ECO:0000269|PubMed:12644968, ECO:0000269|PubMed:29053796}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Inflammatory mediator regulation of TRP channels - Homo sapiens (human);Non-small cell lung cancer - Homo sapiens (human);Focal adhesion - Homo sapiens (human);mTOR signaling pathway - Homo sapiens (human);Aldosterone synthesis and secretion - Homo sapiens (human);Oxytocin signaling pathway - Homo sapiens (human);Fc gamma R-mediated phagocytosis - Homo sapiens (human);VEGF signaling pathway - Homo sapiens (human);Long-term potentiation - Homo sapiens (human);Retrograde endocannabinoid signaling - Homo sapiens (human);Choline metabolism in cancer - Homo sapiens (human);GABAergic synapse - Homo sapiens (human);Serotonergic synapse - Homo sapiens (human);Dopaminergic synapse - Homo sapiens (human);Glutamatergic synapse - Homo sapiens (human);HIF-1 signaling pathway - Homo sapiens (human);Thyroid hormone synthesis - Homo sapiens (human);Long-term depression - Homo sapiens (human);ErbB signaling pathway - Homo sapiens (human);Gap junction - Homo sapiens (human);African trypanosomiasis - Homo sapiens (human);Gastric acid secretion - Homo sapiens (human);Circadian entrainment - Homo sapiens (human);Amoebiasis - Homo sapiens (human);Hepatocellular carcinoma - Homo sapiens (human);Glioma - Homo sapiens (human);Thyroid hormone signaling pathway - Homo sapiens (human);Calcium signaling pathway - Homo sapiens (human);Vascular smooth muscle contraction - Homo sapiens (human);Endocrine and other factor-regulated calcium reabsorption - Homo sapiens (human);Aldosterone-regulated sodium reabsorption - Homo sapiens (human);Rap1 signaling pathway - Homo sapiens (human);Ras signaling pathway - Homo sapiens (human);Salivary secretion - Homo sapiens (human);Pancreatic secretion - Homo sapiens (human);MAPK signaling pathway - Homo sapiens (human);Natural killer cell mediated cytotoxicity - Homo sapiens (human);Sphingolipid signaling pathway - Homo sapiens (human);Phosphatidylinositol signaling system - Homo sapiens (human);Amphetamine addiction - Homo sapiens (human);Proteoglycans in cancer - Homo sapiens (human);MicroRNAs in cancer - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Hepatitis B - Homo sapiens (human);Wnt signaling pathway - Homo sapiens (human);Cholinergic synapse - Homo sapiens (human);Morphine addiction - Homo sapiens (human);Insulin secretion - Homo sapiens (human);Melanogenesis - Homo sapiens (human);EGFR Inhibitor Pathway, Pharmacodynamics;Leukocyte transendothelial migration - Homo sapiens (human);Proton Pump Inhibitor Pathway, Pharmacodynamics;Beta-agonist/Beta-blocker Pathway, Pharmacodynamics;VEGF Signaling Pathway;miRs in Muscle Cell Differentiation;Signaling Pathways in Glioblastoma;Common Pathways Underlying Drug Addiction;Myometrial Relaxation and Contraction Pathways;Focal Adhesion;G Protein Signaling Pathways;Wnt Signaling Pathway;MAPK Signaling Pathway;Wnt Signaling Pathway and Pluripotency;Ras Signaling;Wnt Signaling Pathway;Calcium Regulation in the Cardiac Cell;Signaling by GPCR;Signaling by WNT;Signal Transduction;keratinocyte differentiation;GPCR GroupI metabotropic glutamate receptor;GPCR signaling-G alpha q;Calmodulin induced events;CaM pathway;Neuronal System;Disinhibition of SNARE formation;Response to elevated platelet cytosolic Ca2+;Platelet activation, signaling and aggregation;IL-7 signaling;WNT5A-dependent internalization of FZD4;PCP/CE pathway;Beta-catenin independent WNT signaling;Hemostasis;DAG and IP3 signaling;Thromboxane A2 receptor signaling;JAK STAT pathway and regulation;EPO signaling;Trafficking of GluR2-containing AMPA receptors;Trafficking of AMPA receptors;Glutamate binding, activation of AMPA receptors and synaptic plasticity;Ca-dependent events;PLC beta mediated events;Neurotransmitter receptors and postsynaptic signal transmission;Transmission across Chemical Synapses;G-protein mediated events;Opioid Signalling;G alpha (i) signalling events;G alpha (z) signalling events;Wnt;VEGF;GPCR downstream signalling;Intracellular signaling by second messengers;PAR1-mediated thrombin signaling events;IL8- and CXCR1-mediated signaling events;Retinoic acid receptors-mediated signaling;Role of Calcineurin-dependent NFAT signaling in lymphocytes;Endothelins;IL8- and CXCR2-mediated signaling events
(Consensus)
Recessive Scores
- pRec
- 0.715
Intolerance Scores
- loftool
- 0.130
- rvis_EVS
- -0.71
- rvis_percentile_EVS
- 14.5
Haploinsufficiency Scores
- pHI
- 0.373
- hipred
- Y
- hipred_score
- 0.740
- ghis
- 0.641
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.947
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Prkcg
- Phenotype
- integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); normal phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); immune system phenotype;
Zebrafish Information Network
- Gene name
- prkcg
- Affected structure
- whole organism
- Phenotype tag
- abnormal
- Phenotype quality
- viability
Gene ontology
- Biological process
- protein phosphorylation;chemical synaptic transmission;learning or memory;chemosensory behavior;phosphorylation;peptidyl-serine phosphorylation;platelet activation;negative regulation of protein ubiquitination;regulation of response to food;positive regulation of mismatch repair;intracellular signal transduction;negative regulation of protein catabolic process;regulation of circadian rhythm;response to morphine;negative regulation of neuron apoptotic process;protein autophosphorylation;response to pain;rhythmic process;regulation of phagocytosis;innervation;presynaptic modulation of chemical synaptic transmission;negative regulation of proteasomal protein catabolic process;response to psychosocial stress;regulation of synaptic vesicle exocytosis
- Cellular component
- nucleus;cytosol;plasma membrane;cell-cell junction;postsynaptic density;dendrite;calyx of Held;perinuclear region of cytoplasm;synaptic membrane;presynaptic cytosol;postsynaptic cytosol
- Molecular function
- protein kinase activity;protein serine/threonine kinase activity;protein kinase C activity;calcium-dependent protein kinase C activity;protein serine/threonine/tyrosine kinase activity;ATP binding;zinc ion binding