PRNP

prion protein, the group of CD molecules

Basic information

Region (hg38): 20:4686349-4701590

Previous symbols: [ "PRIP", "GSS", "CJD" ]

Links

ENSG00000171867 ∙ NCBI:5621 ∙ OMIM:176640 ∙ HGNC:9449 ∙ Uniprot:F7VJQ1, P04156 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Gerstmann-Straussler-Scheinker syndrome (Strong), mode of inheritance: AD
• Huntington disease-like 1 (Strong), mode of inheritance: AD
• inherited Creutzfeldt-Jakob disease (Strong), mode of inheritance: AD
• Gerstmann-Straussler-Scheinker syndrome (Definitive), mode of inheritance: AD
• Gerstmann-Straussler-Scheinker syndrome (Supportive), mode of inheritance: AD
• fatal familial insomnia (Supportive), mode of inheritance: AD
• Huntington disease-like 1 (Supportive), mode of inheritance: AD
• familial Alzheimer-like prion disease (Supportive), mode of inheritance: AD
• inherited Creutzfeldt-Jakob disease (Supportive), mode of inheritance: AD
• PrP systemic amyloidosis (Supportive), mode of inheritance: AD
• inherited Creutzfeldt-Jakob disease (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Spongiform encephalopathy with neuropsychiatric features; Huntington disease-like 1; Gerstmann-Straussler disease; Creutzfeldt-Jakob disease; Insomnia, fatal familial; Dementia, Lewy body	AD/AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	2573006; 2572450; 2564168; 2563037; 2190844; 1975028; 2159587; 1683708; 1677164; 1363809; 1439789; 1363810; 12451207; 1346338; 8595485; 9266722; 9384372; 9789072; 9792871; 10581230; 10371520; 9932941; 11593450; 11709001; 15623717; 16769939; 16831973; 17353478; 18360821; 19081515; 22097954; 22210626; 22488860; 22558438; 22561193; 22612156; 22675855; 22763467

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the PRNP gene.

• Huntington disease-like 1 (85 variants)
• Inherited prion disease (51 variants)
• not provided (36 variants)
• Gerstmann-Straussler-Scheinker syndrome (11 variants)
• 6 conditions (10 variants)
• not specified (9 variants)
• Inherited Creutzfeldt-Jakob disease (8 variants)
• Inborn genetic diseases (6 variants)
• Spongiform encephalopathy with neuropsychiatric features (5 variants)
• Fatal familial insomnia (4 variants)
• CEREBRAL AMYLOID ANGIOPATHY, PRNP-RELATED (2 variants)
• Protection against Creutzfeldt-Jakob disease (1 variants)
• Prion disease, susceptibility to (1 variants)
• Alzheimer disease, early-onset, susceptibility to (1 variants)
• PRNP-associated condition (1 variants)
• PRNP-Related Disorders (1 variants)
• Autism spectrum disorder (1 variants)
• Aphasia, primary progressive, susceptibility to (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the PRNP gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			3	26	5	34
missense	6	9	42	5	2	64
nonsense	1	1	1			3
start loss						0
frameshift						0
inframe indel	1		6	3		10
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			16	2	13	31
Total	8	10	68	36	20

Highest pathogenic variant AF is 0.0000263

Variants in PRNP

This is a list of pathogenic ClinVar variants found in the PRNP region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
20-4686501-C-G		Inherited prion disease	Uncertain significance (Jun 14, 2016)
20-4686502-G-T		Inherited prion disease	Uncertain significance (Jan 12, 2018)
20-4686505-C-T		Inherited prion disease	Benign (Jan 12, 2018)
20-4699190-G-A			Benign (Sep 28, 2018)
20-4699225-C-T		Inherited prion disease • Huntington disease-like 1	Conflicting classifications of pathogenicity (Dec 18, 2023)
20-4699226-G-A		Huntington disease-like 1	Likely benign (Feb 14, 2022)
20-4699270-G-C		Huntington disease-like 1	Uncertain significance (Aug 23, 2023)
20-4699274-C-T		Huntington disease-like 1	Likely benign (Jun 21, 2023)
20-4699277-G-A		Huntington disease-like 1	Likely benign (Nov 12, 2021)
20-4699294-G-A		Huntington disease-like 1	Uncertain significance (Mar 03, 2022)
20-4699296-C-G		Inherited prion disease	Uncertain significance (Jan 12, 2018)
20-4699298-G-A			Likely benign (Apr 01, 2023)
20-4699306-G-A		Huntington disease-like 1	Uncertain significance (Jul 07, 2023)
20-4699330-G-A		Inborn genetic diseases	Uncertain significance (Aug 09, 2021)
20-4699336-C-T		Inherited prion disease • Huntington disease-like 1	Conflicting classifications of pathogenicity (Mar 03, 2020)
20-4699337-G-A		Huntington disease-like 1	Likely benign (Oct 31, 2022)
20-4699340-G-A		Huntington disease-like 1	Benign (Feb 06, 2022)
20-4699358-C-T		Huntington disease-like 1	Uncertain significance (Dec 21, 2021)
20-4699363-G-A		Inherited prion disease	Uncertain significance (Mar 09, 2021)
20-4699379-C-T		Inherited prion disease • Huntington disease-like 1 • 6 conditions	Benign/Likely benign (May 09, 2023)
20-4699379-CGGTGGTGGCTGGGGGCAGCCTCAT-C		Inherited prion disease • Huntington disease-like 1 • 6 conditions	Likely benign (Jan 18, 2024)
20-4699379-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT-C		Huntington disease-like 1	Uncertain significance (Mar 27, 2019)
20-4699380-G-A		Inherited prion disease • Huntington disease-like 1	Likely benign (Jan 02, 2024)
20-4699379-C-CGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT		PRNP-associated condition	Pathogenic (Jul 30, 2019)
20-4699379-C-CGGTGGTGGCTGGGGGCAGCCTCAT			Uncertain significance (May 03, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
PRNP	protein_coding	protein_coding	ENST00000379440	1	15355

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000632	0.747	125738	0	8	125746	0.0000318

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.18	111	152	0.731	0.00000905	1663
Missense in Polyphen		39	60.86	0.64081		655
Synonymous	-0.476	63	58.4	1.08	0.00000399	491
Loss of Function	0.950	6	9.09	0.660	4.86e-7	84

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000289	0.0000289
Ashkenazi Jewish	0.000100	0.0000992
East Asian	0.000109	0.0000544
Finnish	0.0000928	0.0000924
European (Non-Finnish)	0.0000265	0.0000264
Middle Eastern	0.000109	0.0000544
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Pathway: Prion diseases - Homo sapiens (human);Ferroptosis - Homo sapiens (human);Human Complement System;Copper homeostasis;Prion disease pathway;Developmental Biology;prion pathway;NCAM signaling for neurite out-growth;NCAM1 interactions;Axon guidance;Glypican 1 network (Consensus)

Recessive Scores

• pRec: 0.664

Intolerance Scores

• loftool: 0.0143
• rvis_EVS: 0.37
• rvis_percentile_EVS: 75.12

Haploinsufficiency Scores

• pHI: 0.318
• hipred: N
• hipred_score: 0.208
• ghis: 0.469

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.982

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Prnp
• Phenotype: endocrine/exocrine gland phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; cellular phenotype; homeostasis/metabolism phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); limbs/digits/tail phenotype; muscle phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; reproductive system phenotype; hematopoietic system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); skeleton phenotype; immune system phenotype; vision/eye phenotype

Gene ontology

• Biological process: negative regulation of protein phosphorylation;cellular copper ion homeostasis;response to oxidative stress;cell cycle arrest;learning or memory;long-term memory;negative regulation of protein processing;protein destabilization;activation of protein kinase activity;negative regulation of interferon-gamma production;negative regulation of interleukin-17 production;negative regulation of interleukin-2 production;calcium-mediated signaling using intracellular calcium source;cellular response to drug;negative regulation of apoptotic process;negative regulation of catalytic activity;negative regulation of DNA-binding transcription factor activity;positive regulation of neuron apoptotic process;negative regulation of activated T cell proliferation;response to cadmium ion;regulation of peptidyl-tyrosine phosphorylation;positive regulation of peptidyl-tyrosine phosphorylation;negative regulation of T cell receptor signaling pathway;protein homooligomerization;positive regulation of protein tyrosine kinase activity;negative regulation of calcineurin-NFAT signaling cascade;cellular response to copper ion;positive regulation of protein targeting to membrane;modulation of age-related behavioral decline;dendritic spine maintenance;negative regulation of long-term synaptic potentiation;regulation of glutamate receptor signaling pathway;positive regulation of neuron death;regulation of potassium ion transmembrane transport;negative regulation of amyloid-beta formation;regulation of intracellular calcium activated chloride channel activity;negative regulation of dendritic spine maintenance;negative regulation of amyloid precursor protein catabolic process;positive regulation of protein localization to plasma membrane;response to amyloid-beta;cellular response to amyloid-beta;regulation of calcium ion import across plasma membrane;neuron projection maintenance
• Cellular component: cytoplasm;endoplasmic reticulum;Golgi apparatus;cytosol;plasma membrane;cell surface;postsynaptic density;inclusion body;extrinsic component of membrane;dendrite;anchored component of external side of plasma membrane;nuclear membrane;intracellular membrane-bounded organelle;membrane raft;extracellular exosome;postsynapse
• Molecular function: amyloid-beta binding;protease binding;copper ion binding;protein binding;lamin binding;glycosaminoglycan binding;microtubule binding;tubulin binding;type 5 metabotropic glutamate receptor binding;type 8 metabotropic glutamate receptor binding;signaling receptor activity;identical protein binding;ATP-dependent protein binding;ion channel binding;protein-containing complex binding;chaperone binding;cupric ion binding;cuprous ion binding