RARA
retinoic acid receptor alpha, the group of Retinoic acid receptors
Basic information
Region (hg38): 17:40309180-40357643
Links
Phenotypes
GenCC
Source:
- acute promyelocytic leukemia (No Known Disease Relationship), mode of inheritance: AD
- multiple congenital anomalies/dysmorphic syndrome (Limited), mode of inheritance: AD
ClinVar
This is a list of variants' phenotypes submitted to
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the RARA gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 4 | |||||
| missense | 15 | 15 | ||||
| nonsense | 0 | |||||
| start loss | 0 | |||||
| frameshift | 0 | |||||
| inframe indel | 0 | |||||
| splice donor/acceptor (+/-2bp) | 0 | |||||
| splice region | 1 | 1 | ||||
| non coding | 2 | |||||
| Total | 0 | 0 | 15 | 3 | 3 |
Variants in RARA
This is a list of pathogenic ClinVar variants found in the RARA region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 17-40331253-G-C | not specified | Uncertain significance (Jan 24, 2023) | ||
| 17-40331268-A-G | not specified | Uncertain significance (Jun 29, 2023) | ||
| 17-40331276-C-G | not specified | Uncertain significance (Dec 21, 2022) | ||
| 17-40331290-C-T | Likely benign (Mar 29, 2018) | |||
| 17-40344694-C-T | Benign (Nov 01, 2022) | |||
| 17-40349788-T-G | not specified | Uncertain significance (Jan 30, 2024) | ||
| 17-40349814-A-G | not specified | Uncertain significance (Jul 11, 2023) | ||
| 17-40349920-A-G | not specified | Uncertain significance (Jul 27, 2024) | ||
| 17-40349934-C-T | Benign (Dec 31, 2019) | |||
| 17-40351964-C-T | not specified | Uncertain significance (Sep 03, 2024) | ||
| 17-40351976-C-T | not specified | Uncertain significance (Sep 20, 2023) | ||
| 17-40351983-G-A | Likely benign (Feb 16, 2018) | |||
| 17-40351985-C-T | not specified | Uncertain significance (Dec 30, 2023) | ||
| 17-40352377-A-T | not specified | Uncertain significance (Nov 28, 2024) | ||
| 17-40352403-T-A | not specified | Uncertain significance (May 30, 2024) | ||
| 17-40354318-C-T | not specified | Uncertain significance (Feb 22, 2023) | ||
| 17-40354320-C-T | Tretinoin response | Uncertain significance; drug response (Jan 14, 2021) | ||
| 17-40354321-G-A | Inborn genetic diseases | Conflicting classifications of pathogenicity (Mar 01, 2022) | ||
| 17-40354331-C-T | Benign (Dec 31, 2019) | |||
| 17-40354463-T-G | not specified | Uncertain significance (Oct 25, 2024) | ||
| 17-40354505-A-C | Mendelian syndromes with cleft lip/palate | Uncertain significance (-) | ||
| 17-40355257-C-T | Benign (Jun 23, 2018) | |||
| 17-40355358-C-T | not specified | Uncertain significance (Dec 08, 2023) | ||
| 17-40356018-G-A | Uncertain significance (Sep 30, 2021) | |||
| 17-40356061-TCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA-T | Tretinoin response | drug response (Mar 01, 2015) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| RARA | protein_coding | protein_coding | ENST00000254066 | 8 | 47651 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.963 | 0.0369 | 125736 | 0 | 6 | 125742 | 0.0000239 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 3.08 | 144 | 292 | 0.493 | 0.0000184 | 2990 |
| Missense in Polyphen | 38 | 132.02 | 0.28783 | 1279 | ||
| Synonymous | 0.101 | 129 | 130 | 0.989 | 0.00000923 | 923 |
| Loss of Function | 3.62 | 2 | 19.1 | 0.105 | 0.00000103 | 219 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.0000585 | 0.0000585 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000379 | 0.0000352 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.00 | 0.00 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. RARA plays an essential role in the regulation of retinoic acid-induced germ cell development during spermatogenesis. Has a role in the survival of early spermatocytes at the beginning prophase of meiosis. In Sertoli cells, may promote the survival and development of early meiotic prophase spermatocytes. In concert with RARG, required for skeletal growth, matrix homeostasis and growth plate function (By similarity). {ECO:0000250|UniProtKB:P11416, ECO:0000269|PubMed:16417524, ECO:0000269|PubMed:19850744, ECO:0000269|PubMed:20215566}.;
- Disease
- DISEASE: Note=Chromosomal aberrations involving RARA are commonly found in acute promyelocytic leukemia. Translocation t(11;17)(q32;q21) with ZBTB16/PLZF; translocation t(15;17)(q21;q21) with PML; translocation t(5;17)(q32;q11) with NPM. The PML-RARA oncoprotein requires both the PML ring structure and coiled-coil domain for both interaction with UBE2I, nuclear microspeckle location and sumoylation. In addition, the coiled- coil domain functions in blocking RA-mediated transactivation and cell differentiation. {ECO:0000269|PubMed:12691149, ECO:0000269|PubMed:8302850, ECO:0000269|PubMed:8562957}.;
- Pathway
- Acute myeloid leukemia - Homo sapiens (human);Estrogen signaling pathway - Homo sapiens (human);Th17 cell differentiation - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Transcriptional misregulation in cancer - Homo sapiens (human);NHR;Nuclear Receptors;White fat cell differentiation;Adipogenesis;Nuclear Receptors in Lipid Metabolism and Toxicity;Wnt-beta-catenin Signaling Pathway in Leukemia;White fat cell differentiation;Vitamin A and Carotenoid Metabolism;Disease;Signal Transduction;Gene expression (Transcription);transcription regulation by methyltransferase of carm1;nuclear receptors coordinate the activities of chromatin remodeling complexes and coactivators to facilitate initiation of transcription in carcinoma cells;Generic Transcription Pathway;Interactions of Rev with host cellular proteins;Host Interactions of HIV factors;HIV Infection;Nuclear Receptor transcription pathway;RNA Polymerase II Transcription;Infectious disease;Nucleosome assembly;degradation of the rar and rxr by the proteasome;Chromosome Maintenance;TP53 regulates transcription of additional cell cycle genes whose exact role in the p53 pathway remain uncertain;TP53 Regulates Transcription of Cell Cycle Genes;Deposition of new CENPA-containing nucleosomes at the centromere;Signaling by Retinoic Acid;Signaling by Nuclear Receptors;RXR and RAR heterodimerization with other nuclear receptor;Transcriptional Regulation by TP53;TFAP2A acts as a transcriptional repressor during retinoic acid induced cell differentiation;Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors;Nuclear import of Rev protein;Cell Cycle;Retinoic acid receptors-mediated signaling
(Consensus)
Recessive Scores
- pRec
- 0.886
Intolerance Scores
- loftool
- 0.0723
- rvis_EVS
- -0.47
- rvis_percentile_EVS
- 23.25
Haploinsufficiency Scores
- pHI
- 0.973
- hipred
- Y
- hipred_score
- 0.831
- ghis
- 0.642
Essentials
- essential_gene_CRISPR
- E
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- K
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.981
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Rara
- Phenotype
- vision/eye phenotype; hearing/vestibular/ear phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); limbs/digits/tail phenotype; digestive/alimentary phenotype; renal/urinary system phenotype; skeleton phenotype; immune system phenotype; respiratory system phenotype; liver/biliary system phenotype; embryo phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; reproductive system phenotype; growth/size/body region phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; craniofacial phenotype; muscle phenotype; cellular phenotype; endocrine/exocrine gland phenotype;
Zebrafish Information Network
- Gene name
- rarab
- Affected structure
- pectoral fin fold
- Phenotype tag
- abnormal
- Phenotype quality
- absent
Gene ontology
- Biological process
- negative regulation of transcription by RNA polymerase II;ureteric bud development;neural tube closure;liver development;glandular epithelial cell development;outflow tract septum morphogenesis;growth plate cartilage development;transcription initiation from RNA polymerase II promoter;protein phosphorylation;signal transduction;multicellular organism development;germ cell development;spermatogenesis;female pregnancy;positive regulation of cell population proliferation;negative regulation of cell population proliferation;hormone-mediated signaling pathway;negative regulation of translation;hippocampus development;cell differentiation;prostate gland development;negative regulation of granulocyte differentiation;embryonic camera-type eye development;regulation of myelination;response to estradiol;response to retinoic acid;negative regulation of interferon-gamma production;negative regulation of tumor necrosis factor production;positive regulation of interleukin-13 production;positive regulation of interleukin-4 production;positive regulation of interleukin-5 production;response to vitamin A;response to lipid;response to cytokine;multicellular organism growth;negative regulation of apoptotic process;apoptotic cell clearance;steroid hormone mediated signaling pathway;response to ethanol;positive regulation of T-helper 2 cell differentiation;positive regulation of neuron differentiation;positive regulation of cell cycle;negative regulation of transcription, DNA-templated;positive regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;regulation of synaptic plasticity;retinoic acid receptor signaling pathway;gland development;positive regulation of binding;ventricular cardiac muscle cell differentiation;Sertoli cell fate commitment;limb development;face development;bone morphogenesis;epithelium development;trachea cartilage development;chondroblast differentiation;negative regulation of cartilage development;cellular response to lipopolysaccharide;cellular response to retinoic acid;cellular response to estrogen stimulus
- Cellular component
- nuclear chromatin;nucleus;nucleoplasm;cytoplasm;cytosol;cell surface;actin cytoskeleton;dendrite;perinuclear region of cytoplasm;RNA polymerase II transcription factor complex
- Molecular function
- translation repressor activity, mRNA regulatory element binding;transcription regulatory region sequence-specific DNA binding;RNA polymerase II regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;retinoic acid binding;DNA-binding transcription factor activity;steroid hormone receptor activity;transcription coactivator activity;transcription corepressor activity;nuclear receptor activity;signaling receptor binding;protein binding;transcription factor binding;drug binding;zinc ion binding;enzyme binding;protein domain specific binding;nuclear receptor transcription coactivator activity;chromatin DNA binding;signaling receptor activity;histone deacetylase binding;protein kinase B binding;retinoic acid-responsive element binding;protein heterodimerization activity;mRNA 5'-UTR binding;protein kinase A binding;alpha-actinin binding