SATB1

SATB homeobox 1, the group of CUT class homeoboxes and pseudogenes

Basic information

Region (hg38): 3:18345377-18445621

Links

ENSG00000182568 ∙ NCBI:6304 ∙ OMIM:602075 ∙ HGNC:10541 ∙ Uniprot:Q01826 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• syndromic intellectual disability (Supportive), mode of inheritance: AD
• developmental delay with dysmorphic facies and dental anomalies (Strong), mode of inheritance: AD
• complex neurodevelopmental disorder (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Developmental delay with dysmorphic facies and dental anomalies; den Hoed-de Boer-Voisin syndrome (Kohlschutter-Tonz syndrome-like)	AD	Cardiovascular	The conditions can involve congenital cardiac anomalies, and awareness may allow early management	Cardiovascular; Craniofacial; Dental; Musculoskeletal; Neurologic; Ophthalmologic	33513338

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SATB1 gene.

• Developmental delay with dysmorphic facies and dental anomalies (4 variants)
• not provided (3 variants)
• Inborn genetic diseases (2 variants)
• Kohlschutter-Tonz syndrome-like (1 variants)
• Neurodevelopmental delay (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SATB1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	7	2	11
missense	2	8	70	2	2	84
nonsense	1	2	2			5
start loss						0
frameshift	6	3	5			14
inframe indel			3	3		6
splice donor/acceptor (+/-2bp)			3			3
splice region			1	1	1	3
non coding			4			4
Total	9	13	89	12	4

Variants in SATB1

This is a list of pathogenic ClinVar variants found in the SATB1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
3-18349194-G-A			Uncertain significance (Sep 01, 2021)
3-18349210-A-G		Inborn genetic diseases	Likely benign (Jan 24, 2024)
3-18349237-GA-G			Uncertain significance (Aug 22, 2022)
3-18349243-A-G		Inborn genetic diseases	Uncertain significance (Nov 20, 2024)
3-18349243-AG-A			Uncertain significance (Jun 02, 2022)
3-18349244-G-T			Uncertain significance (Feb 27, 2023)
3-18349254-AT-A			Uncertain significance (Aug 15, 2019)
3-18349268-C-A		Autism spectrum disorder	Uncertain significance (Feb 17, 2021)
3-18349278-C-A			Uncertain significance (Aug 16, 2024)
3-18349306-T-A		Inborn genetic diseases	Uncertain significance (Nov 30, 2022)
3-18349312-G-A		Developmental delay with dysmorphic facies and dental anomalies	Uncertain significance (Mar 26, 2024)
3-18349325-C-A		Kohlschutter-Tonz syndrome-like	Likely pathogenic (Mar 22, 2023)
3-18349331-CG-C			Uncertain significance (Jul 28, 2022)
3-18349339-T-A		Inborn genetic diseases	Uncertain significance (Apr 25, 2022)
3-18349352-C-T		Neurodevelopmental disorder	Uncertain significance (Mar 31, 2021)
3-18349382-G-A		Developmental delay with dysmorphic facies and dental anomalies	Pathogenic (Jul 03, 2023)
3-18349453-G-C			Uncertain significance (Dec 14, 2022)
3-18349466-C-T			Uncertain significance (Aug 01, 2022)
3-18349483-TGGAGGATTCCCAAGGCTTCCACTGAAATTTTTGTTCGTGGCCGGGTCTTCTGTCGGTTTTCCTCATCTGACTCTGCTGGAGAGGCCACCGTGGGTTGCCGTGG-T		Neurodevelopmental delay	Pathogenic (-)
3-18349516-G-A			Uncertain significance (May 27, 2022)
3-18349520-G-A			Uncertain significance (May 17, 2022)
3-18349525-C-A		SATB1-related disorder	Uncertain significance (Nov 05, 2022)
3-18349525-C-T		Inborn genetic diseases	Uncertain significance (Jun 02, 2024)
3-18349534-T-C		Inborn genetic diseases	Uncertain significance (May 07, 2024)
3-18349537-C-T		Developmental delay with dysmorphic facies and dental anomalies	Uncertain significance (Mar 24, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SATB1	protein_coding	protein_coding	ENST00000417717	11	100202

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.991	0.00949	125742	0	6	125748	0.0000239

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.98	202	436	0.463	0.0000247	5204
Missense in Polyphen		49	156.49	0.31312		1864
Synonymous	-1.07	192	174	1.10	0.0000109	1550
Loss of Function	5.02	6	40.4	0.148	0.00000222	431

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.0000382	0.0000352
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Crucial silencing factor contributing to the initiation of X inactivation mediated by Xist RNA that occurs during embryogenesis and in lymphoma (By similarity). Binds to DNA at special AT-rich sequences, the consensus SATB1-binding sequence (CSBS), at nuclear matrix- or scaffold-associated regions. Thought to recognize the sugar-phosphate structure of double-stranded DNA. Transcriptional repressor controlling nuclear and viral gene expression in a phosphorylated and acetylated status-dependent manner, by binding to matrix attachment regions (MARs) of DNA and inducing a local chromatin-loop remodeling. Acts as a docking site for several chromatin remodeling enzymes (e.g. PML at the MHC-I locus) and also by recruiting corepressors (HDACs) or coactivators (HATs) directly to promoters and enhancers. Modulates genes that are essential in the maturation of the immune T-cell CD8SP from thymocytes. Required for the switching of fetal globin species, and beta- and gamma-globin genes regulation during erythroid differentiation. Plays a role in chromatin organization and nuclear architecture during apoptosis. Interacts with the unique region (UR) of cytomegalovirus (CMV). Alu-like motifs and SATB1- binding sites provide a unique chromatin context which seems preferentially targeted by the HIV-1 integration machinery. Moreover, HIV-1 Tat may overcome SATB1-mediated repression of IL2 and IL2RA (interleukin) in T-cells by binding to the same domain than HDAC1. Delineates specific epigenetic modifications at target gene loci, directly up-regulating metastasis-associated genes while down-regulating tumor-suppressor genes. Reprograms chromatin organization and the transcription profiles of breast tumors to promote growth and metastasis. {ECO:0000250, ECO:0000269|PubMed:10595394, ECO:0000269|PubMed:11463840, ECO:0000269|PubMed:12374985, ECO:0000269|PubMed:12692553, ECO:0000269|PubMed:1505028, ECO:0000269|PubMed:15618465, ECO:0000269|PubMed:15713622, ECO:0000269|PubMed:16377216, ECO:0000269|PubMed:16630892, ECO:0000269|PubMed:17173041, ECO:0000269|PubMed:17376900, ECO:0000269|PubMed:18337816, ECO:0000269|PubMed:19103759, ECO:0000269|PubMed:19247486, ECO:0000269|PubMed:19332023, ECO:0000269|PubMed:19430959, ECO:0000269|PubMed:9111059, ECO:0000269|PubMed:9548713}.
• Pathway: Vitamin D Receptor Pathway;SUMOylation of chromatin organization proteins;Post-translational protein modification;SUMO E3 ligases SUMOylate target proteins;Metabolism of proteins;Apoptotic cleavage of cellular proteins;Apoptotic execution phase;Apoptosis;Programmed Cell Death;SUMOylation;Caspase Cascade in Apoptosis (Consensus)

Recessive Scores

• pRec: 0.158

Intolerance Scores

• loftool: 0.363
• rvis_EVS: -0.58
• rvis_percentile_EVS: 18.59

Haploinsufficiency Scores

• pHI: 0.155
• hipred: Y
• hipred_score: 0.651
• ghis: 0.541

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.896

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Satb1
• Phenotype: growth/size/body region phenotype; endocrine/exocrine gland phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); immune system phenotype; skeleton phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype

Zebrafish Information Network

• Gene name: satb1b
• Affected structure: thrombocyte
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: negative regulation of transcription by RNA polymerase II;chromatin organization;chromatin remodeling;epidermis development;viral process;histone methylation;CD4-positive, alpha-beta T cell differentiation;CD8-positive, alpha-beta T cell differentiation;activated T cell proliferation;reflex
• Cellular component: nucleus;nucleoplasm;nuclear heterochromatin;nuclear matrix;nuclear body;PML body
• Molecular function: RNA polymerase II regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;DNA-binding transcription repressor activity, RNA polymerase II-specific;chromatin binding;double-stranded DNA binding;protein binding;sequence-specific DNA binding