Menu
GeneBe

SATB1

SATB homeobox 1, the group of CUT class homeoboxes and pseudogenes

Basic information

Region (hg38): 3:18345376-18445621

Links

ENSG00000182568NCBI:6304OMIM:602075HGNC:10541Uniprot:Q01826AlphaFoldGenCCjaxSfariGnomADPubmedClinVar

Phenotypes

GenCC

Source: genCC

  • syndromic intellectual disability (Supportive), mode of inheritance: AD
  • developmental delay with dysmorphic facies and dental anomalies (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

ConditionInheritanceIntervention CategoriesIntervention/Rationale Manifestation CategoriesReferences
Developmental delay with dysmorphic facies and dental anomalies; den Hoed-de Boer-Voisin syndrome (Kohlschutter-Tonz syndrome-like)ADCardiovascularThe conditions can involve congenital cardiac anomalies, and awareness may allow early managementCardiovascular; Craniofacial; Dental; Musculoskeletal; Neurologic; Ophthalmologic33513338

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SATB1 gene.

  • not provided (57 variants)
  • Inborn genetic diseases (14 variants)
  • Kohlschutter-Tonz syndrome-like (10 variants)
  • Developmental delay with dysmorphic facies and dental anomalies (10 variants)
  • SATB1-related condition (5 variants)
  • Neurodevelopmental disorder (2 variants)
  • not specified (1 variants)
  • SATB1-related neurodevelopmental disorder (1 variants)
  • Neurodevelopmental delay (1 variants)
  • Autism spectrum disorder (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SATB1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type Pathogenic Likely pathogenic VUS Likely benign Benign Sum
synonymous
2
clinvar
7
clinvar
1
clinvar
10
missense
2
clinvar
6
clinvar
44
clinvar
1
clinvar
2
clinvar
55
nonsense
1
clinvar
2
clinvar
1
clinvar
4
start loss
0
frameshift
5
clinvar
3
clinvar
6
clinvar
14
inframe indel
1
clinvar
2
clinvar
3
splice donor/acceptor (+/-2bp)
2
clinvar
2
splice region
1
1
1
3
non coding
3
clinvar
3
Total 8 11 59 10 3

Highest pathogenic variant AF is 0.00000658

Variants in SATB1

This is a list of pathogenic ClinVar variants found in the SATB1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position Type Phenotype Significance ClinVar
3-18349194-G-A Uncertain significance (Sep 01, 2021)1298907
3-18349237-GA-G Uncertain significance (Aug 22, 2022)2430441
3-18349243-AG-A Uncertain significance (Jun 02, 2022)1803371
3-18349244-G-T Uncertain significance (Feb 27, 2023)2689909
3-18349254-AT-A Uncertain significance (Aug 15, 2019)1316767
3-18349268-C-A Autism spectrum disorder Uncertain significance (Feb 17, 2021)2429855
3-18349306-T-A Inborn genetic diseases Uncertain significance (Nov 30, 2022)2330019
3-18349312-G-A Developmental delay with dysmorphic facies and dental anomalies Uncertain significance (Mar 26, 2024)3065175
3-18349325-C-A Kohlschutter-Tonz syndrome-like Likely pathogenic (Mar 22, 2023)2500309
3-18349331-CG-C Uncertain significance (Jul 28, 2022)1902522
3-18349339-T-A Inborn genetic diseases Uncertain significance (Apr 25, 2022)2285263
3-18349352-C-T Neurodevelopmental disorder Uncertain significance (Mar 31, 2021)1064849
3-18349382-G-A Developmental delay with dysmorphic facies and dental anomalies Pathogenic (Jul 03, 2023)1043592
3-18349453-G-C Uncertain significance (Dec 14, 2022)2429028
3-18349466-C-T Uncertain significance (Aug 01, 2022)1711567
3-18349483-TGGAGGATTCCCAAGGCTTCCACTGAAATTTTTGTTCGTGGCCGGGTCTTCTGTCGGTTTTCCTCATCTGACTCTGCTGGAGAGGCCACCGTGGGTTGCCGTGG-T Neurodevelopmental delay Pathogenic (-)1700168
3-18349516-G-A Uncertain significance (May 27, 2022)1800945
3-18349520-G-A Uncertain significance (May 17, 2022)1800499
3-18349525-C-A SATB1-related condition Uncertain significance (Nov 05, 2022)2631838
3-18349537-C-T Developmental delay with dysmorphic facies and dental anomalies Uncertain significance (Mar 24, 2022)1679146
3-18349538-G-A Developmental delay with dysmorphic facies and dental anomalies Pathogenic (Apr 30, 2021)1439873
3-18349540-T-G SATB1-related condition Uncertain significance (Nov 16, 2023)3031979
3-18349549-T-C Uncertain significance (Jul 19, 2022)2171492
3-18349559-C-A Inborn genetic diseases Likely benign (Aug 17, 2022)2400234
3-18349565-A-AG Developmental delay with dysmorphic facies and dental anomalies Likely pathogenic (Aug 29, 2023)2578423

GnomAD

Source: gnomAD

GeneTypeBio TypeTranscript Coding Exons Length
SATB1protein_codingprotein_codingENST00000417717 11100202
pLI Probability
LOF Intolerant
pRec Probability
LOF Recessive
Individuals with
no LOFs
Individuals with
Homozygous LOFs
Individuals with
Heterozygous LOFs
Defined p
0.9910.00949125742061257480.0000239
Z-Score Observed Expected Observed/Expected Mutation Rate Total Possible in Transcript
Missense3.982024360.4630.00002475204
Missense in Polyphen49156.490.313121864
Synonymous-1.071921741.100.00001091550
Loss of Function5.02640.40.1480.00000222431

LoF frequencies by population

EthnicitySum of pLOFs p
African & African-American0.000.00
Ashkenazi Jewish0.000.00
East Asian0.000.00
Finnish0.00004620.0000462
European (Non-Finnish)0.00003820.0000352
Middle Eastern0.000.00
South Asian0.000.00
Other0.0001630.000163

dbNSFP

Source: dbNSFP

Function
FUNCTION: Crucial silencing factor contributing to the initiation of X inactivation mediated by Xist RNA that occurs during embryogenesis and in lymphoma (By similarity). Binds to DNA at special AT-rich sequences, the consensus SATB1-binding sequence (CSBS), at nuclear matrix- or scaffold-associated regions. Thought to recognize the sugar-phosphate structure of double-stranded DNA. Transcriptional repressor controlling nuclear and viral gene expression in a phosphorylated and acetylated status-dependent manner, by binding to matrix attachment regions (MARs) of DNA and inducing a local chromatin-loop remodeling. Acts as a docking site for several chromatin remodeling enzymes (e.g. PML at the MHC-I locus) and also by recruiting corepressors (HDACs) or coactivators (HATs) directly to promoters and enhancers. Modulates genes that are essential in the maturation of the immune T-cell CD8SP from thymocytes. Required for the switching of fetal globin species, and beta- and gamma-globin genes regulation during erythroid differentiation. Plays a role in chromatin organization and nuclear architecture during apoptosis. Interacts with the unique region (UR) of cytomegalovirus (CMV). Alu-like motifs and SATB1- binding sites provide a unique chromatin context which seems preferentially targeted by the HIV-1 integration machinery. Moreover, HIV-1 Tat may overcome SATB1-mediated repression of IL2 and IL2RA (interleukin) in T-cells by binding to the same domain than HDAC1. Delineates specific epigenetic modifications at target gene loci, directly up-regulating metastasis-associated genes while down-regulating tumor-suppressor genes. Reprograms chromatin organization and the transcription profiles of breast tumors to promote growth and metastasis. {ECO:0000250, ECO:0000269|PubMed:10595394, ECO:0000269|PubMed:11463840, ECO:0000269|PubMed:12374985, ECO:0000269|PubMed:12692553, ECO:0000269|PubMed:1505028, ECO:0000269|PubMed:15618465, ECO:0000269|PubMed:15713622, ECO:0000269|PubMed:16377216, ECO:0000269|PubMed:16630892, ECO:0000269|PubMed:17173041, ECO:0000269|PubMed:17376900, ECO:0000269|PubMed:18337816, ECO:0000269|PubMed:19103759, ECO:0000269|PubMed:19247486, ECO:0000269|PubMed:19332023, ECO:0000269|PubMed:19430959, ECO:0000269|PubMed:9111059, ECO:0000269|PubMed:9548713}.;
Pathway
Vitamin D Receptor Pathway;SUMOylation of chromatin organization proteins;Post-translational protein modification;SUMO E3 ligases SUMOylate target proteins;Metabolism of proteins;Apoptotic cleavage of cellular proteins;Apoptotic execution phase;Apoptosis;Programmed Cell Death;SUMOylation;Caspase Cascade in Apoptosis (Consensus)

Recessive Scores

pRec
0.158

Intolerance Scores

loftool
0.363
rvis_EVS
-0.58
rvis_percentile_EVS
18.59

Haploinsufficiency Scores

pHI
0.155
hipred
Y
hipred_score
0.651
ghis
0.541

Essentials

essential_gene_CRISPR
N
essential_gene_CRISPR2
N
essential_gene_gene_trap
N
gene_indispensability_pred
E
gene_indispensability_score
0.896

Gene Damage Prediction

AllRecessiveDominant
MendelianMediumMediumMedium
Primary ImmunodeficiencyMediumMediumMedium
CancerMediumMediumMedium

Mouse Genome Informatics

Gene name
Satb1
Phenotype
growth/size/body region phenotype; endocrine/exocrine gland phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); immune system phenotype; skeleton phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype;

Zebrafish Information Network

Gene name
satb1b
Affected structure
thrombocyte
Phenotype tag
abnormal
Phenotype quality
decreased amount

Gene ontology

Biological process
negative regulation of transcription by RNA polymerase II;chromatin organization;chromatin remodeling;epidermis development;viral process;histone methylation;CD4-positive, alpha-beta T cell differentiation;CD8-positive, alpha-beta T cell differentiation;activated T cell proliferation;reflex
Cellular component
nucleus;nucleoplasm;nuclear heterochromatin;nuclear matrix;nuclear body;PML body
Molecular function
RNA polymerase II regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;DNA-binding transcription repressor activity, RNA polymerase II-specific;chromatin binding;double-stranded DNA binding;protein binding;sequence-specific DNA binding