SCG3

secretogranin III, the group of Granins

Basic information

Region (hg38): 15:51681491-51721026

Links

ENSG00000104112 ∙ NCBI:29106 ∙ OMIM:611796 ∙ HGNC:13707 ∙ Uniprot:Q8WXD2 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SCG3 gene.

• Inborn genetic diseases (16 variants)
• not provided (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SCG3 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				1	1	2
missense			16			16
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	0	0	16	1	1

Variants in SCG3

This is a list of pathogenic ClinVar variants found in the SCG3 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
15-51683095-A-G		not specified	Uncertain significance (Jul 30, 2023)
15-51683255-A-G		not specified	Uncertain significance (Dec 20, 2023)
15-51683326-T-C		not specified	Uncertain significance (Nov 03, 2022)
15-51683349-T-C			Benign (Apr 04, 2018)
15-51683398-G-C		not specified	Uncertain significance (Mar 14, 2023)
15-51683402-C-G		not specified	Uncertain significance (Dec 20, 2023)
15-51683418-G-A			Likely benign (Apr 01, 2023)
15-51686717-T-TTGTTCAACTGCAACTGGCTGGTGGACTTGGAACTTTTTTTTCTCTCACTTGCCTGGAAAAGTGCAAGGCAAGAACCTGAGAAACGAGCCTGTTATGCAGACCCAAATCATCCTTGCGATGGGC		Schizophrenia	Uncertain significance (Nov 11, 2022)
15-51688290-G-A		not specified	Uncertain significance (Nov 21, 2022)
15-51688400-C-T		not specified	Uncertain significance (Nov 17, 2022)
15-51689327-A-G		not specified	Uncertain significance (Feb 14, 2023)
15-51692159-A-G		not specified	Uncertain significance (May 16, 2023)
15-51692166-T-A		not specified	Uncertain significance (May 04, 2023)
15-51692206-T-G		not specified	Uncertain significance (Aug 17, 2022)
15-51692303-A-G		not specified	Uncertain significance (Jul 06, 2021)
15-51695926-T-C		not specified	Uncertain significance (Dec 21, 2022)
15-51695959-C-A		not specified	Uncertain significance (May 17, 2023)
15-51699349-C-A		not specified	Uncertain significance (Oct 12, 2021)
15-51701113-C-T		not specified	Uncertain significance (Dec 05, 2022)
15-51701126-T-G		not specified	Uncertain significance (Dec 28, 2022)
15-51701221-G-A		not specified	Uncertain significance (Oct 12, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SCG3	protein_coding	protein_coding	ENST00000220478	12	39674

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00149	0.997	125726	0	21	125747	0.0000835

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.355	220	235	0.935	0.0000110	3123
Missense in Polyphen		91	101.91	0.89293		1372
Synonymous	-0.298	89	85.5	1.04	0.00000444	800
Loss of Function	2.82	9	23.8	0.378	0.00000106	337

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000375	0.000373
Ashkenazi Jewish	0.000206	0.000198
East Asian	0.000163	0.000163
Finnish	0.0000464	0.0000462
European (Non-Finnish)	0.0000441	0.0000439
Middle Eastern	0.000163	0.000163
South Asian	0.000103	0.0000980
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Pathway: Post-translational protein phosphorylation;Post-translational protein modification;Metabolism of proteins;Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs);Platelet degranulation ;Response to elevated platelet cytosolic Ca2+;Platelet activation, signaling and aggregation;Hemostasis (Consensus)

Recessive Scores

• pRec: 0.139

Intolerance Scores

• loftool: 0.605
• rvis_EVS: -0.31
• rvis_percentile_EVS: 31.93

Haploinsufficiency Scores

• pHI: 0.576
• hipred: Y
• hipred_score: 0.543
• ghis: 0.610

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.522

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Scg3
• Phenotype: nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); normal phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; growth/size/body region phenotype

Gene ontology

• Biological process: platelet degranulation;post-translational protein modification;cellular protein metabolic process
• Cellular component: extracellular region;endoplasmic reticulum lumen;transport vesicle membrane;secretory granule lumen
• Molecular function: RNA binding