SCG3
Basic information
Region (hg38): 15:51681491-51721026
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
- Inborn genetic diseases (16 variants)
- not provided (2 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the SCG3 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 2 | |||||
missense | 16 | 16 | ||||
nonsense | 0 | |||||
start loss | 0 | |||||
frameshift | 0 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region ? | 0 | |||||
non coding ? | 0 | |||||
Total | 0 | 0 | 16 | 1 | 1 |
Variants in SCG3
This is a list of pathogenic ClinVar variants found in the SCG3 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
15-51683095-A-G | not specified | Uncertain significance (Jul 30, 2023) | ||
15-51683255-A-G | not specified | Uncertain significance (Dec 20, 2023) | ||
15-51683326-T-C | not specified | Uncertain significance (Nov 03, 2022) | ||
15-51683349-T-C | Benign (Apr 04, 2018) | |||
15-51683398-G-C | not specified | Uncertain significance (Mar 14, 2023) | ||
15-51683402-C-G | not specified | Uncertain significance (Dec 20, 2023) | ||
15-51683418-G-A | Likely benign (Apr 01, 2023) | |||
15-51686717-T-TTGTTCAACTGCAACTGGCTGGTGGACTTGGAACTTTTTTTTCTCTCACTTGCCTGGAAAAGTGCAAGGCAAGAACCTGAGAAACGAGCCTGTTATGCAGACCCAAATCATCCTTGCGATGGGC | Schizophrenia | Uncertain significance (Nov 11, 2022) | ||
15-51688290-G-A | not specified | Uncertain significance (Nov 21, 2022) | ||
15-51688400-C-T | not specified | Uncertain significance (Nov 17, 2022) | ||
15-51689327-A-G | not specified | Uncertain significance (Feb 14, 2023) | ||
15-51692159-A-G | not specified | Uncertain significance (May 16, 2023) | ||
15-51692166-T-A | not specified | Uncertain significance (May 04, 2023) | ||
15-51692206-T-G | not specified | Uncertain significance (Aug 17, 2022) | ||
15-51692303-A-G | not specified | Uncertain significance (Jul 06, 2021) | ||
15-51695926-T-C | not specified | Uncertain significance (Dec 21, 2022) | ||
15-51695959-C-A | not specified | Uncertain significance (May 17, 2023) | ||
15-51699349-C-A | not specified | Uncertain significance (Oct 12, 2021) | ||
15-51701113-C-T | not specified | Uncertain significance (Dec 05, 2022) | ||
15-51701126-T-G | not specified | Uncertain significance (Dec 28, 2022) | ||
15-51701221-G-A | not specified | Uncertain significance (Oct 12, 2021) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
SCG3 | protein_coding | protein_coding | ENST00000220478 | 12 | 39674 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.00149 | 0.997 | 125726 | 0 | 21 | 125747 | 0.0000835 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 0.355 | 220 | 235 | 0.935 | 0.0000110 | 3123 |
Missense in Polyphen | 91 | 101.91 | 0.89293 | 1372 | ||
Synonymous | -0.298 | 89 | 85.5 | 1.04 | 0.00000444 | 800 |
Loss of Function | 2.82 | 9 | 23.8 | 0.378 | 0.00000106 | 337 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.000375 | 0.000373 |
Ashkenazi Jewish | 0.000206 | 0.000198 |
East Asian | 0.000163 | 0.000163 |
Finnish | 0.0000464 | 0.0000462 |
European (Non-Finnish) | 0.0000441 | 0.0000439 |
Middle Eastern | 0.000163 | 0.000163 |
South Asian | 0.000103 | 0.0000980 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Pathway
- Post-translational protein phosphorylation;Post-translational protein modification;Metabolism of proteins;Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs);Platelet degranulation ;Response to elevated platelet cytosolic Ca2+;Platelet activation, signaling and aggregation;Hemostasis
(Consensus)
Recessive Scores
- pRec
- 0.139
Intolerance Scores
- loftool
- 0.605
- rvis_EVS
- -0.31
- rvis_percentile_EVS
- 31.93
Haploinsufficiency Scores
- pHI
- 0.576
- hipred
- Y
- hipred_score
- 0.543
- ghis
- 0.610
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.522
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Scg3
- Phenotype
- nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); normal phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; growth/size/body region phenotype;
Gene ontology
- Biological process
- platelet degranulation;post-translational protein modification;cellular protein metabolic process
- Cellular component
- extracellular region;endoplasmic reticulum lumen;transport vesicle membrane;secretory granule lumen
- Molecular function
- RNA binding