SELENON

selenoprotein N, the group of Selenoproteins|EF-hand domain containing

Basic information

Region (hg38): 1:25800193-25818221

Previous symbols: [ "RSMD1", "MDRS1", "SEPN1" ]

Links

ENSG00000162430 ∙ NCBI:57190 ∙ OMIM:606210 ∙ HGNC:15999 ∙ Uniprot:Q9NZV5 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• congenital fiber-type disproportion myopathy (Supportive), mode of inheritance: AD
• desmin-related myopathy with Mallory body-like inclusions (Supportive), mode of inheritance: AR
• rigid spine syndrome (Supportive), mode of inheritance: AR
• congenital myopathy 4A, autosomal dominant (Strong), mode of inheritance: AR
• SELENON-related myopathy (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Congenital myopathy 3 with rigid spine; Myopathy, congenital, with fiber-type disproportion	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Musculoskeletal	7224095; 11528383; 12192640; 15122708; 16365872; 20301436; 20301467; 21670436
Cardiac involvement has been described in some individuals

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SELENON gene.

• Eichsfeld type congenital muscular dystrophy (43 variants)
• not provided (13 variants)
• Congenital myopathy with fiber type disproportion (2 variants)
• Eichsfeld type congenital muscular dystrophy;Congenital myopathy with fiber type disproportion (1 variants)
• SELENON-related myopathy (1 variants)
• Abnormality of the musculature (1 variants)
• Congenital myopathy 4A, autosomal dominant (1 variants)
• See cases (1 variants)
• Muscular dystrophy (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SELENON gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			4	103	4	111
missense		11	193	7	5	216
nonsense	11	7	1			19
start loss	9	1				10
frameshift	22	5	3			30
inframe indel		2	6			8
splice donor/acceptor (+/-2bp)	4	10	4			18
splice region			15	22	2	39
non coding	1		45	91	47	184
Total	47	36	256	201	56

Highest pathogenic variant AF is 0.000118

Variants in SELENON

This is a list of pathogenic ClinVar variants found in the SELENON region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
1-25800195-TTCCCGGGCCGCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCC-T		Eichsfeld type congenital muscular dystrophy	Pathogenic (Feb 11, 2022)
1-25800196-T-C		not specified • SEPN1-related disorder	Conflicting classifications of pathogenicity (Jan 13, 2018)
1-25800197-CCCGGGCCGCCGGCAGCCGCCGCCAGCCGCAGCCATGGG-C		Eichsfeld type congenital muscular dystrophy	Pathogenic (Jul 06, 2022)
1-25800201-G-GGCCGCCGGCA		not specified	Likely benign (Jan 22, 2018)
1-25800205-GCCGGCAGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCTGCCGCCGCCGTCCGGGTCTGCGCCCGCCACGCCGAGGCCCAGGCGGCCGCGCGGCAGGT-G		Eichsfeld type congenital muscular dystrophy	Pathogenic (Aug 09, 2023)
1-25800209-G-GCAGCCGCCGC			Likely benign (Sep 01, 2022)
1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGC-A		Congenital myopathy with fiber type disproportion • Eichsfeld type congenital muscular dystrophy	Pathogenic (Dec 14, 2022)
1-25800212-G-C			Uncertain significance (Nov 21, 2014)
1-25800211-AGCCGCCGCCAGCCGCAGCCATGGGCCGGGCCCGGCCGGGCCAACGCGGGCCGCCCAGCCCCGGCCCCGCCGCGCAGCCTCCCGCGCCACCGCGCCGCCGCGCCCGTTCCCTGGCGCTGCTCGGAGCCCTGCTGGCCGCCGCCGCT-A		Eichsfeld type congenital muscular dystrophy	Pathogenic (Dec 11, 2023)
1-25800217-C-A		SEPN1-related disorder • SELENON-related disorder	Uncertain significance (Jan 13, 2018)
1-25800219-C-T			Uncertain significance (Jul 14, 2015)
1-25800230-C-A		SEPN1-related disorder	Uncertain significance (Jan 12, 2018)
1-25800230-C-T		not specified	Likely benign (Apr 06, 2015)
1-25800231-A-G		Eichsfeld type congenital muscular dystrophy • Congenital myopathy with fiber type disproportion • Congenital myopathy with fiber type disproportion;Eichsfeld type congenital muscular dystrophy	Pathogenic/Likely pathogenic (Feb 04, 2023)
1-25800232-T-A		Eichsfeld type congenital muscular dystrophy	Pathogenic/Likely pathogenic (Apr 30, 2021)
1-25800232-T-C		Eichsfeld type congenital muscular dystrophy	Pathogenic (Jun 27, 2022)
1-25800232-T-G		Eichsfeld type congenital muscular dystrophy	Pathogenic/Likely pathogenic (Aug 13, 2024)
1-25800232-TGGGCCGGGCCCGGCCGGGCCAACGC-T		Eichsfeld type congenital muscular dystrophy	Pathogenic (Jun 05, 2023)
1-25800232-T-TGGGCC		Eichsfeld type congenital muscular dystrophy	Pathogenic (Sep 07, 2022)
1-25800232-T-TGGGCCGTGCC		Eichsfeld type congenital muscular dystrophy	Pathogenic (Jul 16, 2021)
1-25800234-G-T		Eichsfeld type congenital muscular dystrophy • Inborn genetic diseases • Eichsfeld type congenital muscular dystrophy;Congenital myopathy with fiber type disproportion	Uncertain significance (Mar 01, 2023)
1-25800233-G-GGCCC		Eichsfeld type congenital muscular dystrophy	Pathogenic (Aug 13, 2024)
1-25800233-G-GGGCCGGGCCC		Eichsfeld type congenital muscular dystrophy	Pathogenic (Apr 23, 2024)
1-25800237-C-A		Eichsfeld type congenital muscular dystrophy	Conflicting classifications of pathogenicity (Oct 17, 2023)
1-25800237-C-G		Eichsfeld type congenital muscular dystrophy	Uncertain significance (Feb 24, 2020)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SELENON	protein_coding	protein_coding	ENST00000361547	13	18047

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
9.79e-10	0.742	124739	0	93	124832	0.000373

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.424	275	296	0.931	0.0000194	3803
Missense in Polyphen		77	83.602	0.92103		957
Synonymous	-1.37	148	128	1.15	0.00000948	1196
Loss of Function	1.49	18	26.2	0.686	0.00000143	309

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000493	0.000489
Ashkenazi Jewish	0.00139	0.00139
East Asian	0.000313	0.000278
Finnish	0.000232	0.000232
European (Non-Finnish)	0.000361	0.000353
Middle Eastern	0.000313	0.000278
South Asian	0.000341	0.000327
Other	0.000990	0.000989

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Isoform 2: Plays an important role in cell protection against oxidative stress and in the regulation of redox-related calcium homeostasis. Regulates the calcium level of the ER by protecting the calcium pump ATP2A2 against the oxidoreductase ERO1A-mediated oxidative damage. Within the ER, ERO1A activity increases the concentration of H(2)O(2), which attacks the luminal thiols in ATP2A2 and thus leads to cysteinyl sulfenic acid formation (-SOH) and SEPN1 reduces the SOH back to free thiol (- SH), thus restoring ATP2A2 activity (PubMed:25452428). Acts as a modulator of ryanodine receptor (RyR) activity: protects RyR from oxidation due to increased oxidative stress, or directly controls the RyR redox state, regulating the RyR-mediated calcium mobilization required for normal muscle development and differentiation (PubMed:19557870, PubMed:18713863). {ECO:0000269|PubMed:18713863, ECO:0000269|PubMed:19557870, ECO:0000269|PubMed:25452428}.
• Disease: DISEASE: Rigid spine muscular dystrophy 1 (RSMD1) [MIM:602771]: A neuromuscular disorder characterized by poor axial muscle strength, scoliosis and neck weakness, and a variable degree of spinal rigidity. Early ventilatory insufficiency can lead to death by respiratory failure. {ECO:0000269|PubMed:11528383, ECO:0000269|PubMed:12192640, ECO:0000269|PubMed:15122708, ECO:0000269|PubMed:15668457, ECO:0000269|PubMed:18713863, ECO:0000269|PubMed:19067361}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Myopathy, congenital, with fiber-type disproportion (CFTD) [MIM:255310]: A genetically heterogeneous disorder in which there is relative hypotrophy of type 1 muscle fibers compared to type 2 fibers on skeletal muscle biopsy. However, these findings are not specific and can be found in many different myopathic and neuropathic conditions. {ECO:0000269|PubMed:16365872}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Selenium Micronutrient Network;Selenium Metabolism and Selenoproteins (Consensus)

Recessive Scores

• pRec: 0.202

Intolerance Scores

• rvis_EVS: 0.62
• rvis_percentile_EVS: 83.42

Haploinsufficiency Scores

• pHI: 0.146
• hipred: N
• hipred_score: 0.251
• ghis: 0.447

Essentials

• essential_gene_gene_trap: N

Mouse Genome Informatics

• Gene name: Selenon
• Phenotype: growth/size/body region phenotype; homeostasis/metabolism phenotype; cellular phenotype; muscle phenotype; normal phenotype; respiratory system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); skeleton phenotype

Zebrafish Information Network

• Gene name: selenon
• Affected structure: slow muscle cell
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: respiratory system process;mitochondrion organization;skeletal muscle satellite cell differentiation;skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration;positive regulation of skeletal muscle cell proliferation;response to muscle activity involved in regulation of muscle adaptation;multicellular organismal response to stress;cellular response to oxidative stress;lung alveolus development;skeletal muscle fiber development;calcium ion homeostasis;oxidation-reduction process;regulation of ryanodine-sensitive calcium-release channel activity;cellular response to caffeine;positive regulation of response to oxidative stress
• Cellular component: endoplasmic reticulum membrane
• Molecular function: calcium ion binding;protein binding;oxidoreductase activity