SIGMAR1

sigma non-opioid intracellular receptor 1

Basic information

Region (hg38): 9:34634722-34637844

Previous symbols: [ "OPRS1" ]

Links

ENSG00000147955 ∙ NCBI:10280 ∙ OMIM:601978 ∙ HGNC:8157 ∙ Uniprot:Q99720 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• amyotrophic lateral sclerosis type 16 (Moderate), mode of inheritance: AR
• autosomal recessive distal spinal muscular atrophy 2 (Supportive), mode of inheritance: AR
• juvenile amyotrophic lateral sclerosis (Supportive), mode of inheritance: AR
• autosomal recessive distal spinal muscular atrophy 2 (Strong), mode of inheritance: AR
• amyotrophic lateral sclerosis type 16 (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Amyotrophic lateral sclerosis 16, juvenile; Frontotemporal lobar degeneration-motor neuron disease; Neuronopathy, distal hereditary motor, autosomal recessive 2	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	18755042; 21031579; 21842496; 26078401

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SIGMAR1 gene.

• Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16 (5 variants)
• Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2 (4 variants)
• Amyotrophic lateral sclerosis type 16 (2 variants)
• Inborn genetic diseases (2 variants)
• Autosomal recessive distal spinal muscular atrophy 2 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SIGMAR1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				44	2	46
missense	1	4	74	1	1	81
nonsense	4					4
start loss						0
frameshift	5	1	1			7
inframe indel			3			3
splice donor/acceptor (+/-2bp)		1				1
splice region			2	6	1	9
non coding			1	16	5	22
Total	10	6	79	61	8

Highest pathogenic variant AF is 0.0000263

Variants in SIGMAR1

This is a list of pathogenic ClinVar variants found in the SIGMAR1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
9-34635581-C-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Nov 11, 2020)
9-34635591-CGCTCCTGTCTATCCGCAGGTCTTCCTTCAGGCCTGGCTGGTCAAGGGTCCTGGCCAAAGAGGTAGGTGGTGAGCTCAAGCCGGAGGCCCCGAGCATAGGAGCGAAGAGTATAGAAGAGGGTGAGGAAGTCCTGGGTGCTGAAGACAGTGTCGGCCAGCGCGAAGGCCAGGGTGGATGGGATGACGCCCCGGCCGTACTCCACCATCCATGTGTTTGGCCCCCACTCCACAGCTGTTGCCTCACCAGGCCCGTGTACTACCGTCTCCCCTGGGGGACAGGGAGCACCCAAGTG-C		Amyotrophic lateral sclerosis type 16	Likely pathogenic (-)
9-34635601-T-C		Amyotrophic lateral sclerosis type 16 • Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16 • Autosomal recessive distal spinal muscular atrophy 2	Benign (Jan 24, 2024)
9-34635605-C-T			Likely benign (Sep 16, 2020)
9-34635644-G-A		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Likely benign (Nov 14, 2023)
9-34635646-CAA-C		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Aug 26, 2021)
9-34635652-G-A		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Uncertain significance (Oct 12, 2019)
9-34635665-C-T		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Likely benign (Oct 01, 2023)
9-34635667-C-T		Amyotrophic lateral sclerosis type 16	Likely pathogenic (Feb 02, 2022)
9-34635672-C-T		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2 • Inborn genetic diseases	Conflicting classifications of pathogenicity (Dec 30, 2023)
9-34635673-G-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Oct 13, 2023)
9-34635677-G-T		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Likely benign (Sep 20, 2018)
9-34635678-C-T			Uncertain significance (Apr 11, 2023)
9-34635681-C-G		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Jul 21, 2022)
9-34635681-C-T		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Jan 02, 2024)
9-34635682-G-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16 • not specified	Benign/Likely benign (Jan 29, 2024)
9-34635686-A-G		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Likely benign (Apr 25, 2023)
9-34635687-T-G		Inborn genetic diseases	Uncertain significance (Apr 13, 2021)
9-34635690-G-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Uncertain significance (Jun 03, 2022)
9-34635699-G-A			Uncertain significance (Jun 07, 2022)
9-34635704-G-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Likely benign (Jan 20, 2023)
9-34635709-G-A		Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16 • Inborn genetic diseases	Uncertain significance (Sep 02, 2021)
9-34635727-TGCTGAAGACAGTGTCG-T		Amyotrophic lateral sclerosis type 16 • Autosomal recessive distal spinal muscular atrophy 2;Amyotrophic lateral sclerosis type 16	Conflicting classifications of pathogenicity (Apr 08, 2022)
9-34635729-C-T		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Uncertain significance (Apr 09, 2021)
9-34635733-A-G		Amyotrophic lateral sclerosis type 16;Autosomal recessive distal spinal muscular atrophy 2	Uncertain significance (May 22, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SIGMAR1	protein_coding	protein_coding	ENST00000277010	4	3088

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.168	0.820	125720	0	8	125728	0.0000318

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.46	85	132	0.642	0.00000736	1389
Missense in Polyphen		36	53.852	0.6685		620
Synonymous	0.657	52	58.4	0.891	0.00000328	467
Loss of Function	2.15	3	10.5	0.285	4.60e-7	99

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000129	0.000129
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.0000360	0.0000352
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Functions in lipid transport from the endoplasmic reticulum and is involved in a wide array of cellular functions probably through regulation of the biogenesis of lipid microdomains at the plasma membrane. Involved in the regulation of different receptors it plays a role in BDNF signaling and EGF signaling. Also regulates ion channels like the potassium channel and could modulate neurotransmitter release. Plays a role in calcium signaling through modulation together with ANK2 of the ITP3R-dependent calcium efflux at the endoplasmic reticulum. Plays a role in several other cell functions including proliferation, survival and death. Originally identified for its ability to bind various psychoactive drugs it is involved in learning processes, memory and mood alteration (PubMed:16472803, PubMed:9341151). Necessary for proper mitochondrial axonal transport in motor neurons, in particular the retrograde movement of mitochondria. Plays a role in protecting cells against oxidative stress-induced cell death via its interaction with RNF112 (By similarity). {ECO:0000250|UniProtKB:O55242, ECO:0000269|PubMed:16472803, ECO:0000269|PubMed:9341151}.
• Disease: DISEASE: Amyotrophic lateral sclerosis 16, juvenile (ALS16) [MIM:614373]: A neurodegenerative disorder affecting upper motor neurons in the brain and lower motor neurons in the brain stem and spinal cord, resulting in fatal paralysis. Sensory abnormalities are absent. The pathologic hallmarks of the disease include pallor of the corticospinal tract due to loss of motor neurons, presence of ubiquitin-positive inclusions within surviving motor neurons, and deposition of pathologic aggregates. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of the cases. {ECO:0000269|PubMed:21842496}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Distal spinal muscular atrophy, autosomal recessive, 2 (DSMA2) [MIM:605726]: An autosomal recessive neuromuscular disorder characterized by onset of distal muscle weakness and wasting affecting the lower and upper limbs in the first decade. There is no sensory involvement. {ECO:0000269|PubMed:26078401, ECO:0000269|PubMed:27629094}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: miR-targeted genes in lymphocytes - TarBase;miR-targeted genes in squamous cell - TarBase (Consensus)

Recessive Scores

• pRec: 0.221

Intolerance Scores

• loftool: 0.517
• rvis_EVS: 0.08
• rvis_percentile_EVS: 59.76

Haploinsufficiency Scores

• pHI: 0.557
• hipred: Y
• hipred_score: 0.546
• ghis: 0.523

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.763

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Sigmar1
• Phenotype: behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Gene ontology

• Biological process: lipid transport;nervous system development;cell death in response to hydrogen peroxide;opioid receptor signaling pathway;regulation of neuron apoptotic process;protein homotrimerization
• Cellular component: nuclear envelope;nuclear inner membrane;nuclear outer membrane;endoplasmic reticulum;endoplasmic reticulum membrane;lipid droplet;integral component of plasma membrane;postsynaptic density;integral component of membrane;cell junction;growth cone;cytoplasmic vesicle;postsynaptic membrane
• Molecular function: opioid receptor activity;drug binding