SIX6

SIX homeobox 6, the group of SINE class homeoboxes

Basic information

Region (hg38): 14:60509145-60512850

Previous symbols: [ "OPTX2" ]

Links

ENSG00000184302 ∙ NCBI:4990 ∙ OMIM:606326 ∙ HGNC:10892 ∙ Uniprot:O95475 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (Limited), mode of inheritance: AD
• colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (Strong), mode of inheritance: AR
• colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (Strong), mode of inheritance: AR
• colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (Supportive), mode of inheritance: AR
• colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (Limited), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Microphthalmia, isolated, with cataract 2; Optic disc anomalies with retinal and/or macular dystrophy	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Ophthalmologic	15266624; 23167593; 24702266

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SIX6 gene.

• not provided (78 variants)
• Anophthalmia-microphthalmia syndrome (32 variants)
• Inborn genetic diseases (9 variants)
• Colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (4 variants)
• not specified (2 variants)
• Anophthalmia/microphthalmia-esophageal atresia syndrome;Colobomatous optic disc-macular atrophy-chorioretinopathy syndrome (1 variants)
• Developmental cataract;Congenital cornea plana;Microphthalmia;Sclerocornea (1 variants)
• Nystagmus;Developmental cataract;Microcornea;Sclerocornea (1 variants)
• See cases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SIX6 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			3	22	1	26
missense	1	1	42	1	1	46
nonsense		1	2			3
start loss	1					1
frameshift		2	2			4
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			11	5	3	19
Total	2	4	60	28	5

Variants in SIX6

This is a list of pathogenic ClinVar variants found in the SIX6 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
14-60509167-GCCGGCGTGCCTGAGCCGAGCCGAGCCCGAACCCCAAGCCGCGGAGCCAGCACCTCCTCCAGTCGGGGTCGTCCGCTCCCGGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGGCTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCTTCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATATCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGTACCGAGTAAGGAAGAAGTTCCCGCTGCCGCGCACCATTTGGGACGGCGAACAGAAGACACACTGCTTCAAGGAGCGCACGCGGCACCTGCTACGCGAGTGGTACCTGCAGGATCCATACCCTAACCCCAGCAAAAAACGTGAGCTCGCCCAGGCAACCGGACTGACCCCTACGCAGGTGGGCAACTGGTTCAAAAACCGCCGACAAAGGGACCGAGCGGCTGCAGCCAAGAACAGGTCGGTACCTAGAGGCCTCCGCGCTTTGAGCGCACCGGGGAGGAGGCGGGTGGAGGCACCTCTGGCGCCCTTACCCAGTCCCTGGCGACTCCAATTCAGCAGGAGTTGGGAGCGCGGTCTGTCTTGGGTTAAGAGCCCTGCGTTCTGGGCTCCTGGCCGGGAGTTCCCTTGCCGGCTCTGCTTCCCCACCCGCTGGCTCCCCACGCCTGCGGGCAGCTGCAGCAGCTGGTC-G		Sclerocornea;Developmental cataract;Cornea plana;Microphthalmia	Pathogenic (-)
14-60509225-C-G		Anophthalmia-microphthalmia syndrome	Uncertain significance (Jan 13, 2018)
14-60509238-T-C		Anophthalmia-microphthalmia syndrome	Benign (Jun 26, 2018)
14-60509250-C-T		Anophthalmia-microphthalmia syndrome	Likely benign (Jan 13, 2018)
14-60509252-T-C		Anophthalmia-microphthalmia syndrome	Likely benign (Apr 24, 2019)
14-60509285-G-A		Anophthalmia-microphthalmia syndrome	Uncertain significance (Jan 12, 2018)
14-60509335-C-T		Anophthalmia-microphthalmia syndrome	Likely benign (Mar 24, 2019)
14-60509408-C-A			Uncertain significance (Sep 10, 2021)
14-60509410-G-C			Likely benign (Nov 15, 2022)
14-60509416-C-A		Anophthalmia-microphthalmia syndrome	Conflicting classifications of pathogenicity (Jun 01, 2022)
14-60509416-C-T			Benign (Jan 24, 2024)
14-60509419-G-A		Anophthalmia-microphthalmia syndrome	Benign/Likely benign (Jan 31, 2024)
14-60509432-C-A			Uncertain significance (Mar 22, 2023)
14-60509463-A-T			Uncertain significance (Sep 06, 2022)
14-60509473-C-A			Likely benign (Jan 01, 2023)
14-60509474-G-A			Uncertain significance (Feb 20, 2022)
14-60509489-G-C			Uncertain significance (Aug 22, 2022)
14-60509494-C-T		Anophthalmia-microphthalmia syndrome	Uncertain significance (Jan 12, 2018)
14-60509503-G-A			Likely pathogenic (Feb 01, 2024)
14-60509508-T-C		Colobomatous optic disc-macular atrophy-chorioretinopathy syndrome	Pathogenic (Feb 01, 2015)
14-60509512-C-T			Likely benign (Jul 03, 2023)
14-60509519-C-T			Uncertain significance (Jun 15, 2022)
14-60509521-T-C			Likely benign (Jan 26, 2024)
14-60509522-G-A		not specified	Uncertain significance (May 17, 2023)
14-60509533-G-C		not specified	Uncertain significance (Jan 22, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SIX6	protein_coding	protein_coding	ENST00000327720	2	3900

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.518	0.479	125730	0	12	125742	0.0000477

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.714	117	141	0.831	0.00000634	1550
Missense in Polyphen		30	50.409	0.59514		564
Synonymous	0.938	55	64.6	0.852	0.00000303	529
Loss of Function	2.44	2	10.6	0.189	4.75e-7	100

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000155	0.000148
Ashkenazi Jewish	0.00	0.00
East Asian	0.000110	0.000109
Finnish	0.00	0.00
European (Non-Finnish)	0.0000448	0.0000440
Middle Eastern	0.000110	0.000109
South Asian	0.0000328	0.0000327
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May be involved in eye development.
• Pathway: Ectoderm Differentiation (Consensus)

Recessive Scores

• pRec: 0.125

Intolerance Scores

• loftool: 0.223
• rvis_EVS: 0.68
• rvis_percentile_EVS: 84.93

Haploinsufficiency Scores

• pHI: 0.313
• hipred: Y
• hipred_score: 0.837

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.928

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	High
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Six6
• Phenotype: endocrine/exocrine gland phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype

Zebrafish Information Network

• Gene name: six6b
• Affected structure: mandibular arch skeleton
• Phenotype tag: abnormal
• Phenotype quality: shortened

Gene ontology

• Biological process: eye development;visual perception;animal organ morphogenesis;negative regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;anatomical structure development
• Cellular component: nucleus;transcription factor complex
• Molecular function: transcription regulatory region sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific