SLC16A2
Basic information
Region (hg38): X:74421493-74533917
Previous symbols: [ "DXS128", "AHDS", "MRX22" ]
Links
Phenotypes
GenCC
Source:
- Allan-Herndon-Dudley syndrome (Strong), mode of inheritance: XL
- Allan-Herndon-Dudley syndrome (Supportive), mode of inheritance: XL
- Allan-Herndon-Dudley syndrome (Definitive), mode of inheritance: XL
- Allan-Herndon-Dudley syndrome (Definitive), mode of inheritance: XL
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Allan-Herndon-Dudley syndrome | XL | Endocrine; Obstetric | In affected males, treatment with thyroid hormone has not been described as affecting the neurologic phenotype, but heterozygous women may benefit from monitoring and levothyroxine treatment during pregnancy in order to prevent fetal/neonatal hypothyroidism (regardless of fetal variant status) | Craniofacial; Endocrine; Musculoskeletal; Neurologic | 8484404; 15488219; 14661163; 15889350; 15980113; 18398436; 19194886; 20301789; 20713192; 21098685; 21415082; 21468521 |
ClinVar
This is a list of variants' phenotypes submitted to
- Allan-Herndon-Dudley syndrome (28 variants)
- Spastic paraplegia (16 variants)
- not provided (10 variants)
- Inborn genetic diseases (7 variants)
- Intellectual disability (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC16A2 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 46 | 56 | ||||
missense | 17 | 118 | 19 | 169 | ||
nonsense | 18 | 22 | ||||
start loss | 2 | |||||
frameshift | 17 | 10 | 28 | |||
inframe indel | 9 | |||||
splice donor/acceptor (+/-2bp) | 5 | |||||
splice region | 1 | 2 | 3 | |||
non coding | 17 | 28 | ||||
Total | 49 | 35 | 135 | 82 | 18 |
Variants in SLC16A2
This is a list of pathogenic ClinVar variants found in the SLC16A2 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
X-74421509-G-A | Inborn genetic diseases | Uncertain significance (Apr 05, 2023) | ||
X-74421510-A-G | Inborn genetic diseases | Uncertain significance (Sep 28, 2022) | ||
X-74421514-T-C | Inborn genetic diseases | Likely benign (Sep 20, 2019) | ||
X-74421518-G-A | Likely benign (Oct 09, 2017) | |||
X-74421523-AGGCAGC-A | not specified | Benign/Likely benign (Jun 28, 2017) | ||
X-74421523-A-AGGCAGC | Inborn genetic diseases • Spastic paraplegia • Allan-Herndon-Dudley syndrome | Benign/Likely benign (Feb 01, 2025) | ||
X-74421529-C-A | Inborn genetic diseases | Uncertain significance (Jan 22, 2024) | ||
X-74421538-C-T | not specified | Benign (Nov 02, 2017) | ||
X-74421552-C-T | Inborn genetic diseases | Uncertain significance (Dec 16, 2024) | ||
X-74421558-G-C | Inborn genetic diseases | Uncertain significance (Jul 22, 2024) | ||
X-74421585-A-C | Allan-Herndon-Dudley syndrome | Uncertain significance (Aug 07, 2013) | ||
X-74421626-C-A | Inborn genetic diseases | Likely benign (Apr 17, 2024) | ||
X-74421631-CGCCGCGATGGCGCTGCAAAGCCAGGCGAGCGAGGAAGCAAAGGGGCCCTGGCAGGAGGCAGACCAGGAACAGCAGGAGCCGGTGGGTAGCCCAGAGCCGGAGTCTGAGCCGGAGCCTGAGCCCGAGCCCGAGCCCGTGCCAGTGCCCCCGCCCGAGCCCCAGCCGGAGCCCCAGCCCCTACCGGACCCCGCACCCCTGCCGGAGCTGGAGTTCGAGTCCGAGCGGGTGCACGAACCCGAGCCCACGCCTACGGTAGAGACCCGCGGCACCGCGCGCGGCTTCCAGCCTCCCGAAGGTGGCTTCGGCTGGGTGGTGGTGTTCGCTGCCACCTGGTGCAACGGCTCCATCTTCGGCATCCATAACTCTGTCGGGATCCTCTACTCCATGCTGCTAGAGGAGGAAAAGGAAAAAAATCGCCAAGTGGAGTTCCAAGCAGGTGAG-C | Allan-Herndon-Dudley syndrome | Pathogenic (May 13, 2021) | ||
X-74421635-G-C | Uncertain significance (Sep 01, 2023) | |||
X-74421639-T-G | Spastic paraplegia | Pathogenic (Aug 19, 2022) | ||
X-74421643-G-GC | Spastic paraplegia | Pathogenic (Nov 18, 2022) | ||
X-74421653-C-T | SLC16A2-related disorder | Likely pathogenic (Jun 17, 2023) | ||
X-74421654-A-C | Inborn genetic diseases | Likely benign (Jan 03, 2024) | ||
X-74421660-G-A | Spastic paraplegia • not specified • Inborn genetic diseases | Benign (Dec 31, 2024) | ||
X-74421661-C-G | Spastic paraplegia | Uncertain significance (Nov 30, 2022) | ||
X-74421662-G-A | Allan-Herndon-Dudley syndrome | Uncertain significance (Apr 27, 2019) | ||
X-74421662-G-T | Spastic paraplegia • Allan-Herndon-Dudley syndrome | Pathogenic (Apr 25, 2024) | ||
X-74421665-G-T | Inborn genetic diseases | Pathogenic (Jun 29, 2019) | ||
X-74421683-C-T | Spastic paraplegia | Pathogenic (Apr 23, 2021) | ||
X-74421684-A-G | Inborn genetic diseases | Likely benign (Jan 03, 2024) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
SLC16A2 | protein_coding | protein_coding | ENST00000587091 | 6 | 112668 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.988 | 0.0117 | 0 | 0 | 0 | 0 | 0.00 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 2.38 | 126 | 227 | 0.555 | 0.0000182 | 3504 |
Missense in Polyphen | 25 | 90.967 | 0.27483 | 1405 | ||
Synonymous | 0.889 | 81 | 91.8 | 0.882 | 0.00000727 | 1124 |
Loss of Function | 3.39 | 0 | 13.4 | 0.00 | 0.00000100 | 202 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00 | 0.00 |
Ashkenazi Jewish | 0.00 | 0.00 |
East Asian | 0.00 | 0.00 |
Finnish | 0.00 | 0.00 |
European (Non-Finnish) | 0.00 | 0.00 |
Middle Eastern | 0.00 | 0.00 |
South Asian | 0.00 | 0.00 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Very active and specific thyroid hormone transporter. Stimulates cellular uptake of thyroxine (T4), triiodothyronine (T3), reverse triiodothyronine (rT3) and diidothyronine. Does not transport Leu, Phe, Trp or Tyr. {ECO:0000269|PubMed:23550058, ECO:0000269|PubMed:26426690}.;
- Pathway
- Thyroid hormone signaling pathway - Homo sapiens (human);Angiopoietin Like Protein 8 Regulatory Pathway;Tyrosine metabolism;Transport of vitamins, nucleosides, and related molecules;SLC-mediated transmembrane transport;Transport of small molecules;Transport of organic anions
(Consensus)
Recessive Scores
- pRec
- 0.215
Intolerance Scores
- loftool
- rvis_EVS
- 0.1
- rvis_percentile_EVS
- 61.49
Haploinsufficiency Scores
- pHI
- 0.153
- hipred
- Y
- hipred_score
- 0.662
- ghis
- 0.511
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.187
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Slc16a2
- Phenotype
- homeostasis/metabolism phenotype;
Zebrafish Information Network
- Gene name
- slc16a2
- Affected structure
- Rohon-Beard neuron
- Phenotype tag
- abnormal
- Phenotype quality
- has fewer parts of type
Gene ontology
- Biological process
- monocarboxylic acid transport;sodium-independent organic anion transport;transmembrane transport;thyroid hormone transport
- Cellular component
- plasma membrane;integral component of plasma membrane
- Molecular function
- transporter activity;monocarboxylic acid transmembrane transporter activity;symporter activity;thyroid hormone transmembrane transporter activity