SLC16A2

solute carrier family 16 member 2, the group of Solute carrier family 16

Basic information

Region (hg38): X:74421493-74533917

Previous symbols: [ "DXS128", "AHDS", "MRX22" ]

Links

ENSG00000147100 ∙ NCBI:6567 ∙ OMIM:300095 ∙ HGNC:10923 ∙ Uniprot:P36021 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Allan-Herndon-Dudley syndrome (Definitive), mode of inheritance: XLR
• Allan-Herndon-Dudley syndrome (Strong), mode of inheritance: XL
• Allan-Herndon-Dudley syndrome (Supportive), mode of inheritance: XL
• Allan-Herndon-Dudley syndrome (Definitive), mode of inheritance: XL
• Allan-Herndon-Dudley syndrome (Definitive), mode of inheritance: XL

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Allan-Herndon-Dudley syndrome	XL	Endocrine; Obstetric	In affected males, treatment with thyroid hormone has not been described as affecting the neurologic phenotype, but heterozygous women may benefit from monitoring and levothyroxine treatment during pregnancy in order to prevent fetal/neonatal hypothyroidism (regardless of fetal variant status)	Craniofacial; Endocrine; Musculoskeletal; Neurologic	8484404; 15488219; 14661163; 15889350; 15980113; 18398436; 19194886; 20301789; 20713192; 21098685; 21415082; 21468521

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC16A2 gene.

• Allan-Herndon-Dudley syndrome (27 variants)
• Spastic paraplegia (16 variants)
• not provided (9 variants)
• Inborn genetic diseases (6 variants)
• Intellectual disability (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC16A2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	44	7	53
missense	8	13	111	19	7	158
nonsense	18	3				21
start loss	2					2
frameshift	16	9	1			26
inframe indel	1	2	5			8
splice donor/acceptor (+/-2bp)	1	1				2
splice region	1		1	2		4
non coding			6	15	4	25
Total	46	28	125	78	18

Variants in SLC16A2

This is a list of pathogenic ClinVar variants found in the SLC16A2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-74421509-G-A		Inborn genetic diseases	Uncertain significance (Apr 05, 2023)
X-74421510-A-G		Inborn genetic diseases	Uncertain significance (Sep 28, 2022)
X-74421514-T-C		Inborn genetic diseases	Likely benign (Sep 20, 2019)
X-74421518-G-A			Likely benign (Oct 09, 2017)
X-74421523-AGGCAGC-A		not specified	Benign/Likely benign (Jun 28, 2017)
X-74421523-A-AGGCAGC		Spastic paraplegia • Inborn genetic diseases • Allan-Herndon-Dudley syndrome	Benign/Likely benign (Aug 23, 2022)
X-74421529-C-A		Inborn genetic diseases	Uncertain significance (Jan 22, 2024)
X-74421538-C-T		not specified	Benign (Nov 02, 2017)
X-74421585-A-C		Allan-Herndon-Dudley syndrome	Uncertain significance (Aug 07, 2013)
X-74421626-C-A		Inborn genetic diseases	Likely benign (Apr 17, 2024)
X-74421631-CGCCGCGATGGCGCTGCAAAGCCAGGCGAGCGAGGAAGCAAAGGGGCCCTGGCAGGAGGCAGACCAGGAACAGCAGGAGCCGGTGGGTAGCCCAGAGCCGGAGTCTGAGCCGGAGCCTGAGCCCGAGCCCGAGCCCGTGCCAGTGCCCCCGCCCGAGCCCCAGCCGGAGCCCCAGCCCCTACCGGACCCCGCACCCCTGCCGGAGCTGGAGTTCGAGTCCGAGCGGGTGCACGAACCCGAGCCCACGCCTACGGTAGAGACCCGCGGCACCGCGCGCGGCTTCCAGCCTCCCGAAGGTGGCTTCGGCTGGGTGGTGGTGTTCGCTGCCACCTGGTGCAACGGCTCCATCTTCGGCATCCATAACTCTGTCGGGATCCTCTACTCCATGCTGCTAGAGGAGGAAAAGGAAAAAAATCGCCAAGTGGAGTTCCAAGCAGGTGAG-C		Allan-Herndon-Dudley syndrome	Pathogenic (May 13, 2021)
X-74421635-G-C			Uncertain significance (Sep 01, 2023)
X-74421639-T-G		Spastic paraplegia	Pathogenic (Aug 19, 2022)
X-74421643-G-GC		Spastic paraplegia	Pathogenic (Nov 18, 2022)
X-74421653-C-T		SLC16A2-related disorder	Likely pathogenic (Jun 17, 2023)
X-74421654-A-C		Inborn genetic diseases	Likely benign (Jan 03, 2024)
X-74421660-G-A		Spastic paraplegia • not specified • Inborn genetic diseases	Benign (Jan 30, 2024)
X-74421661-C-G		Spastic paraplegia	Uncertain significance (Nov 30, 2022)
X-74421662-G-A		Allan-Herndon-Dudley syndrome	Uncertain significance (Apr 27, 2019)
X-74421662-G-T		Spastic paraplegia • Allan-Herndon-Dudley syndrome	Pathogenic (Feb 07, 2024)
X-74421665-G-T		Inborn genetic diseases	Pathogenic (Jun 29, 2019)
X-74421683-C-T		Spastic paraplegia	Pathogenic (Apr 23, 2021)
X-74421684-A-G		Inborn genetic diseases	Likely benign (Jan 03, 2024)
X-74421689-G-A		Spastic paraplegia	Uncertain significance (Sep 16, 2021)
X-74421694-C-A			Uncertain significance (May 07, 2019)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC16A2	protein_coding	protein_coding	ENST00000587091	6	112668

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.988	0.0117	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.38	126	227	0.555	0.0000182	3504
Missense in Polyphen		25	90.967	0.27483		1405
Synonymous	0.889	81	91.8	0.882	0.00000727	1124
Loss of Function	3.39	0	13.4	0.00	0.00000100	202

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Very active and specific thyroid hormone transporter. Stimulates cellular uptake of thyroxine (T4), triiodothyronine (T3), reverse triiodothyronine (rT3) and diidothyronine. Does not transport Leu, Phe, Trp or Tyr. {ECO:0000269|PubMed:23550058, ECO:0000269|PubMed:26426690}.
• Pathway: Thyroid hormone signaling pathway - Homo sapiens (human);Angiopoietin Like Protein 8 Regulatory Pathway;Tyrosine metabolism;Transport of vitamins, nucleosides, and related molecules;SLC-mediated transmembrane transport;Transport of small molecules;Transport of organic anions (Consensus)

Recessive Scores

• pRec: 0.215

Intolerance Scores

• rvis_EVS: 0.1
• rvis_percentile_EVS: 61.49

Haploinsufficiency Scores

• pHI: 0.153
• hipred: Y
• hipred_score: 0.662
• ghis: 0.511

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.187

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc16a2
• Phenotype: homeostasis/metabolism phenotype

Zebrafish Information Network

• Gene name: slc16a2
• Affected structure: Rohon-Beard neuron
• Phenotype tag: abnormal
• Phenotype quality: has fewer parts of type

Gene ontology

• Biological process: monocarboxylic acid transport;sodium-independent organic anion transport;transmembrane transport;thyroid hormone transport
• Cellular component: plasma membrane;integral component of plasma membrane
• Molecular function: transporter activity;monocarboxylic acid transmembrane transporter activity;symporter activity;thyroid hormone transmembrane transporter activity