SLC22A5
solute carrier family 22 member 5, the group of Solute carrier family 22
Basic information
Region (hg38): 5:132369710-132395613
Previous symbols: [ "CDSP" ]
Links
Phenotypes
GenCC
Source:
- systemic primary carnitine deficiency disease (Definitive), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Definitive), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Strong), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Strong), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Supportive), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Definitive), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Definitive), mode of inheritance: AR
- systemic primary carnitine deficiency disease (Definitive), mode of inheritance: AR
- short QT syndrome (Disputed Evidence), mode of inheritance: AR
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Carnitine deficiency, systemic primary | AR | Biochemical; Pharmacogenomic | Early disease recognition with prompt carnitine therapy can be immediately life-saving and beneficial long-term; Certain agents (eg, specific antibiotics) have been reported to precipitate severe reactions, and should be avoided | Biochemical; Cardiovascular; Gastrointestinal; Musculoskeletal; Neurologic | 234182; 7432384; 7254270; 7131143; 3974805; 3181209; 3185635; 2235122; 1763895; 2235122; 9826541; 9700603; 11261427; 9634512; 9916797; 11715001; 12210323; 15303004; 16652335; 17126586; 20027113; 20574985; 21922592; 22566287; 22989098; 23379544 |
ClinVar
This is a list of variants' phenotypes submitted to
- Renal carnitine transport defect (86 variants)
- not provided (19 variants)
- Decreased circulating carnitine concentration (8 variants)
- not specified (2 variants)
- Inborn genetic diseases (2 variants)
- Congenital myasthenic syndrome 20 (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC22A5 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 258 | 268 | ||||
| missense | 22 | 62 | 316 | 14 | 414 | |
| nonsense | 20 | 20 | 42 | |||
| start loss | 6 | |||||
| frameshift | 31 | 32 | 64 | |||
| inframe indel | 10 | |||||
| splice donor/acceptor (+/-2bp) | 10 | 23 | 33 | |||
| splice region | 1 | 15 | 36 | 1 | 53 | |
| non coding | 29 | 111 | 39 | 181 | ||
| Total | 88 | 144 | 360 | 383 | 43 |
Highest pathogenic variant AF is 0.0000525
Variants in SLC22A5
This is a list of pathogenic ClinVar variants found in the SLC22A5 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 5-132369739-C-G | Renal carnitine transport defect | Benign (Apr 27, 2017) | ||
| 5-132369742-G-C | Renal carnitine transport defect | Uncertain significance (Jan 12, 2018) | ||
| 5-132369766-C-G | Renal carnitine transport defect | Benign (Jan 29, 2024) | ||
| 5-132369766-C-C | Inflammatory bowel disease 5 | Uncertain significance (Mar 01, 2007) | ||
| 5-132369767-A-C | Renal carnitine transport defect | Uncertain significance (Jan 13, 2018) | ||
| 5-132369824-G-A | Renal carnitine transport defect • SLC22A5-related disorder • Inborn genetic diseases | Pathogenic (Sep 23, 2024) | ||
| 5-132369834-G-T | Renal carnitine transport defect | Benign (Jan 13, 2018) | ||
| 5-132369842-A-C | Renal carnitine transport defect | Uncertain significance (Jan 18, 2018) | ||
| 5-132369842-ACCCTCCGCGGACGGTCTTGGGTCGCCTG-A | Renal carnitine transport defect | Uncertain significance (Feb 13, 2018) | ||
| 5-132369855-G-A | Renal carnitine transport defect | Likely benign (Aug 14, 2018) | ||
| 5-132369866-G-T | Renal carnitine transport defect | Benign (Jan 12, 2018) | ||
| 5-132369873-G-C | Benign/Likely benign (Nov 01, 2022) | |||
| 5-132369881-TGCCTGGTCGGCGGCGGGTGCCCCGCGCGCACGCGCAAAGCCCGCCGCGTTCCCCGACCCCAGGCCGCGCTCTGTGGGCCTCTGAGGGCGGCATGCGGGACTACGACGAGGTGA-T | Renal carnitine transport defect | Likely pathogenic (May 24, 2018) | ||
| 5-132369895-C-T | Renal carnitine transport defect • not specified | Benign (Dec 18, 2021) | ||
| 5-132369895-CG-TA | Benign (Jul 31, 2017) | |||
| 5-132369896-G-A | Renal carnitine transport defect • not specified | Benign (Dec 18, 2021) | ||
| 5-132369943-G-C | Renal carnitine transport defect | Uncertain significance (Jan 12, 2018) | ||
| 5-132369947-G-A | not specified • Renal carnitine transport defect | Conflicting classifications of pathogenicity (Jul 15, 2021) | ||
| 5-132369948-C-T | Renal carnitine transport defect | Uncertain significance (Jul 15, 2021) | ||
| 5-132369973-A-G | Renal carnitine transport defect | Likely pathogenic (Aug 30, 2017) | ||
| 5-132369973-A-T | Renal carnitine transport defect | Likely pathogenic (Nov 02, 2017) | ||
| 5-132369974-T-C | Renal carnitine transport defect | Pathogenic (Jan 21, 2024) | ||
| 5-132369974-T-G | Renal carnitine transport defect | Likely pathogenic (Feb 15, 2018) | ||
| 5-132369975-G-T | Renal carnitine transport defect | Likely pathogenic (Sep 08, 2016) | ||
| 5-132369975-G-GC | Renal carnitine transport defect | Pathogenic (Jan 01, 1999) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| SLC22A5 | protein_coding | protein_coding | ENST00000245407 | 10 | 25863 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 5.27e-16 | 0.0133 | 125643 | 0 | 105 | 125748 | 0.000418 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | -0.357 | 332 | 314 | 1.06 | 0.0000173 | 3591 |
| Missense in Polyphen | 79 | 78.584 | 1.0053 | 889 | ||
| Synonymous | -0.847 | 144 | 132 | 1.09 | 0.00000752 | 1180 |
| Loss of Function | 0.160 | 24 | 24.9 | 0.965 | 0.00000135 | 262 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.000723 | 0.000724 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00169 | 0.00169 |
| Finnish | 0.000370 | 0.000370 |
| European (Non-Finnish) | 0.000318 | 0.000316 |
| Middle Eastern | 0.00169 | 0.00169 |
| South Asian | 0.000395 | 0.000392 |
| Other | 0.000327 | 0.000326 |
dbNSFP
Source:
- Function
- FUNCTION: Sodium-ion dependent, high affinity carnitine transporter. Involved in the active cellular uptake of carnitine. Transports one sodium ion with one molecule of carnitine. Also transports organic cations such as tetraethylammonium (TEA) without the involvement of sodium. Also relative uptake activity ratio of carnitine to TEA is 11.3. {ECO:0000269|PubMed:10454528}.;
- Pathway
- Choline metabolism in cancer - Homo sapiens (human);Metabolism of lipids;Import of palmitoyl-CoA into the mitochondrial matrix;Metabolism;Fatty acid metabolism;Transport of bile salts and organic acids, metal ions and amine compounds;SLC-mediated transmembrane transport;Transport of small molecules;Organic cation transport;Lipoate metabolism;Organic cation/anion/zwitterion transport;Glycerophospholipid metabolism;Glycine, serine, alanine and threonine metabolism
(Consensus)
Recessive Scores
- pRec
- 0.286
Intolerance Scores
- loftool
- 0.403
- rvis_EVS
- 0.8
- rvis_percentile_EVS
- 87.66
Haploinsufficiency Scores
- pHI
- 0.176
- hipred
- N
- hipred_score
- 0.224
- ghis
- 0.439
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.255
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Slc22a5
- Phenotype
- growth/size/body region phenotype; homeostasis/metabolism phenotype; liver/biliary system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); reproductive system phenotype; renal/urinary system phenotype;
Zebrafish Information Network
- Gene name
- slc22a5
- Affected structure
- nucleate erythrocyte
- Phenotype tag
- abnormal
- Phenotype quality
- decreased amount
Gene ontology
- Biological process
- sodium ion transport;drug transmembrane transport;quaternary ammonium group transport;carnitine transport;drug transport;quorum sensing involved in interaction with host;positive regulation of intestinal epithelial structure maintenance;sodium-dependent organic cation transport;carnitine transmembrane transport
- Cellular component
- plasma membrane;integral component of membrane;apical plasma membrane;brush border membrane;extracellular exosome
- Molecular function
- protein binding;ATP binding;carnitine transmembrane transporter activity;drug transmembrane transporter activity;symporter activity;quaternary ammonium group transmembrane transporter activity;PDZ domain binding