SLC25A12

solute carrier family 25 member 12, the group of Solute carrier family 25|EF-hand domain containing

Basic information

Region (hg38): 2:171783404-171999859

Links

ENSG00000115840 ∙ NCBI:8604 ∙ OMIM:603667 ∙ HGNC:10982 ∙ Uniprot:O75746 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• developmental and epileptic encephalopathy, 39 (Moderate), mode of inheritance: AR
• developmental and epileptic encephalopathy, 39 (Supportive), mode of inheritance: AR
• developmental and epileptic encephalopathy, 39 (Strong), mode of inheritance: AR
• mitochondrial disease (Moderate), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Developmental and epileptic encephalopathy 39 with leukodystrophy	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	19641205

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC25A12 gene.

• not provided (413 variants)
• Developmental and epileptic encephalopathy, 39 (17 variants)
• Inborn genetic diseases (17 variants)
• Seizure (1 variants)
• Developmental and epileptic encephalopathy, 1 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC25A12 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	90	5	101
missense		2	178	1	2	183
nonsense	2	1				3
start loss						0
frameshift	3	1				4
inframe indel			5			5
splice donor/acceptor (+/-2bp)	1	4				5
splice region			16	16	1	33
non coding			4	70	13	87
Total	6	8	193	161	20

Highest pathogenic variant AF is 0.00000658

Variants in SLC25A12

This is a list of pathogenic ClinVar variants found in the SLC25A12 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-171784280-G-A		Developmental and epileptic encephalopathy, 39	Uncertain significance (Jun 14, 2016)
2-171785269-T-C		SLC25A12-related disorder	Likely benign (Jul 12, 2019)
2-171785278-T-A			Uncertain significance (Aug 16, 2022)
2-171785280-AGTGGCTGCCACTGCTGCCTTTGGCTGAACCACAGCAACACTAGGAGACTTAAATTTCGGGAGATAAAGGCCAAATTTGTTTTCGATGCCTGCAAAC-A			Uncertain significance (Jan 22, 2021)
2-171785282-T-A			Uncertain significance (Dec 18, 2023)
2-171785291-C-G			Uncertain significance (Dec 05, 2019)
2-171785295-TG-T		Seizure • Inborn genetic diseases	Conflicting classifications of pathogenicity (Jan 29, 2024)
2-171785302-G-A		Inborn genetic diseases	Uncertain significance (Aug 10, 2023)
2-171785310-C-T			Likely benign (Oct 28, 2023)
2-171785313-A-G			Likely benign (Dec 06, 2022)
2-171785330-T-G			Uncertain significance (Oct 13, 2022)
2-171785332-A-T			Uncertain significance (Jun 05, 2021)
2-171785334-T-C			Likely benign (Apr 15, 2023)
2-171785337-C-T			Likely benign (Oct 12, 2023)
2-171785338-G-A			Uncertain significance (Aug 04, 2023)
2-171785342-G-A			Uncertain significance (Nov 19, 2023)
2-171785348-G-A			Uncertain significance (Aug 27, 2021)
2-171785358-G-A			Likely benign (Nov 08, 2023)
2-171785363-C-T			Uncertain significance (Aug 28, 2021)
2-171785364-G-A			Likely benign (Jun 20, 2022)
2-171785364-G-C			Uncertain significance (Feb 03, 2022)
2-171785368-C-T			Uncertain significance (Aug 19, 2022)
2-171785376-C-T			Likely benign (Jan 22, 2023)
2-171785377-G-A			Uncertain significance (Dec 11, 2023)
2-171785387-C-T			Uncertain significance (Nov 01, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC25A12	protein_coding	protein_coding	ENST00000422440	18	223887

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.216	0.784	125736	0	12	125748	0.0000477

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.71	226	373	0.605	0.0000209	4399
Missense in Polyphen		49	126.07	0.38868		1508
Synonymous	-0.718	141	131	1.08	0.00000711	1360
Loss of Function	4.34	9	37.8	0.238	0.00000212	446

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000905	0.0000905
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000544	0.0000544
Finnish	0.00	0.00
European (Non-Finnish)	0.0000616	0.0000615
Middle Eastern	0.0000544	0.0000544
South Asian	0.0000653	0.0000653
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Mitochondrial and calcium-binding carrier that catalyzes the calcium-dependent exchange of cytoplasmic glutamate with mitochondrial aspartate across the mitochondrial inner membrane (PubMed:11566871, PubMed:25410934). May have a function in the urea cycle (PubMed:11566871). {ECO:0000269|PubMed:11566871, ECO:0000269|PubMed:25410934}.
• Disease: DISEASE: Epileptic encephalopathy, early infantile, 39 (EIEE39) [MIM:612949]: A form of epileptic encephalopathy, a heterogeneous group of severe childhood onset epilepsies characterized by refractory seizures, neurodevelopmental impairment, and poor prognosis. Development is normal prior to seizure onset, after which cognitive and motor delays become apparent. EIEE39 is characterized by global hypomyelination of the central nervous system, with the gray matter appearing relatively unaffected. Inheritance is autosomal recessive. {ECO:0000269|PubMed:19641205, ECO:0000269|PubMed:24515575}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Argininemia;Citrullinemia Type I;Carbamoyl Phosphate Synthetase Deficiency;Argininosuccinic Aciduria;Malate-Aspartate Shuttle;Urea Cycle;Ornithine Transcarbamylase Deficiency (OTC Deficiency);Metabolism of carbohydrates;Metabolism of proteins;Purine metabolism;Metabolism;Methionine and cysteine metabolism;Vitamin B9 (folate) metabolism;Mitochondrial protein import;Gluconeogenesis;Glucose metabolism (Consensus)

Recessive Scores

• pRec: 0.154

Intolerance Scores

• loftool: 0.211
• rvis_EVS: -0.42
• rvis_percentile_EVS: 25.56

Haploinsufficiency Scores

• pHI: 0.330
• hipred: Y
• hipred_score: 0.575
• ghis: 0.573

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.828

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc25a12
• Phenotype: nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); homeostasis/metabolism phenotype; cellular phenotype; growth/size/body region phenotype

Gene ontology

• Biological process: gluconeogenesis;glutamate biosynthetic process;positive regulation of glucose metabolic process;aspartate transmembrane transport;L-glutamate transmembrane transport;positive regulation of myelination;malate-aspartate shuttle;response to calcium ion;L-aspartate transmembrane transport;negative regulation of glucose catabolic process to lactate via pyruvate;positive regulation of ATP biosynthetic process
• Cellular component: mitochondrion;mitochondrial inner membrane;integral component of membrane;myelin sheath
• Molecular function: L-glutamate transmembrane transporter activity;calcium ion binding;acidic amino acid transmembrane transporter activity;L-aspartate transmembrane transporter activity;identical protein binding