SLC25A15

solute carrier family 25 member 15, the group of Solute carrier family 25|MicroRNA protein coding host genes

Basic information

Region (hg38): 13:40789411-40812460

Previous symbols: [ "ORNT1", "HHH" ]

Links

ENSG00000102743 ∙ NCBI:10166 ∙ OMIM:603861 ∙ HGNC:10985 ∙ Uniprot:Q9Y619 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• ornithine translocase deficiency (Definitive), mode of inheritance: AR
• ornithine translocase deficiency (Strong), mode of inheritance: AR
• ornithine translocase deficiency (Supportive), mode of inheritance: AR
• ornithine translocase deficiency (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome	AR	Biochemical	Dietary (eg, low protein diet,) and medical therapy (eg, with ornithine, citrulline and phenylbutyrate sodium), including during pregnancy, has been reported as beneficial	Biochemical; Gastrointestinal; Neurologic	5782534; 3091924; 3116497; 3670619; 3106719; 3407856; 2222247; 10369256; 11355015; 11552031; 16940241; 18978333; 19242930; 20574716; 22465082; 25135652

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC25A15 gene.

• Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome (338 variants)
• not provided (44 variants)
• not specified (17 variants)
• Inborn genetic diseases (11 variants)
• SLC25A15-related condition (4 variants)
• Intellectual disability (1 variants)
• Intellectual disability;Abnormal facial shape (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC25A15 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	90	2	94
missense	2	11	58	2	2	75
nonsense	8	6				14
start loss						0
frameshift	15	10				25
inframe indel	1					1
splice donor/acceptor (+/-2bp)	1	7				8
splice region			2	15	2	19
non coding			49	39	31	119
Total	27	34	109	131	35

Highest pathogenic variant AF is 0.0000460

Variants in SLC25A15

This is a list of pathogenic ClinVar variants found in the SLC25A15 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
13-40789413-G-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jun 14, 2016)
13-40789429-C-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jun 14, 2016)
13-40789459-T-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Benign (Jun 29, 2018)
13-40789460-C-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Conflicting classifications of pathogenicity (Feb 01, 2023)
13-40789474-G-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Benign/Likely benign (Aug 31, 2021)
13-40789488-C-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jun 14, 2016)
13-40789566-G-A		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jun 14, 2016)
13-40789613-C-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Mar 30, 2018)
13-40789632-C-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jan 13, 2018)
13-40793115-TGCTGCAGACTTGGACTAATGGTGAACTCTTGCCTCCCCCCAGGGATATGTGGTGCCTGTCATAAGCTCCAGAGAGCTGCCTTCCACAAGACCAGCAGAAGAGTGGGCAAACATGAAATCCAATCCTGCTATCCAGGCTGCCATTGACCTCACAGCGGGGGCTGCAGGTACAGTCATGTGCCTCATCACCATGTTTCTGTCGTTGATGGATGGTGTATCTGATG-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely pathogenic (May 08, 2023)
13-40793142-T-A		not specified	Likely benign (Jun 25, 2016)
13-40793160-A-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Benign/Likely benign (Sep 01, 2021)
13-40793186-G-A		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Jan 12, 2018)
13-40793195-C-T		not specified	Likely benign (Jul 29, 2016)
13-40793227-A-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Pathogenic (Feb 28, 2023)
13-40793237-A-G		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Feb 18, 2022)
13-40793242-G-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Apr 04, 2022)
13-40793244-T-C		not specified • Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely benign (Dec 31, 2023)
13-40793247-C-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely benign (Dec 25, 2020)
13-40793248-C-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome • Cardiac arrhythmia • Hereditary breast ovarian cancer syndrome	Pathogenic (Mar 20, 2024)
13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely pathogenic (Jun 08, 2023)
13-40793258-T-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Uncertain significance (Mar 31, 2022)
13-40793268-A-C		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely benign (Jul 15, 2023)
13-40793270-C-T		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Likely pathogenic (-)
13-40793271-G-A		Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome	Conflicting classifications of pathogenicity (Aug 31, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC25A15	protein_coding	protein_coding	ENST00000338625	6	20700

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
3.70e-7	0.361	125705	0	43	125748	0.000171

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.101	160	164	0.978	0.00000980	1946
Missense in Polyphen		61	63.187	0.96539		717
Synonymous	-0.560	70	64.3	1.09	0.00000415	606
Loss of Function	0.556	11	13.2	0.835	7.24e-7	164

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000408	0.000408
Ashkenazi Jewish	0.0000992	0.0000992
East Asian	0.000761	0.000761
Finnish	0.000139	0.000139
European (Non-Finnish)	0.0000615	0.0000615
Middle Eastern	0.000761	0.000761
South Asian	0.000196	0.000196
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Ornithine-citrulline antiporter. Connects the cytosolic and the intramitochondrial reactions of the urea cycle by exchanging cytosolic ornithine with matrix citrulline (PubMed:12807890). The stoichiometry is close to 1:1 (By similarity). {ECO:0000250|UniProtKB:A0A0G2K309, ECO:0000269|PubMed:12807890}.
• Pathway: Argininemia;Hyperornithinemia with gyrate atrophy (HOGA);Creatine deficiency, guanidinoacetate methyltransferase deficiency;L-arginine:glycine amidinotransferase deficiency;Hyperornithinemia-hyperammonemia-homocitrullinuria [HHH-syndrome];Guanidinoacetate Methyltransferase Deficiency (GAMT Deficiency);Citrullinemia Type I;Carbamoyl Phosphate Synthetase Deficiency;Argininosuccinic Aciduria;Urea Cycle;Prolinemia Type II;Prolidase Deficiency (PD);Ornithine Transcarbamylase Deficiency (OTC Deficiency);Arginine and Proline Metabolism;Hyperprolinemia Type I;Hyperprolinemia Type II;Ornithine Aminotransferase Deficiency (OAT Deficiency);Arginine: Glycine Amidinotransferase Deficiency (AGAT Deficiency);Metabolism of polyamines;Metabolism of amino acids and derivatives;Metabolism;Urea cycle and metabolism of arginine, proline, glutamate, aspartate and asparagine;Vitamin H (biotin) metabolism;Urea cycle (Consensus)

Intolerance Scores

• loftool: 0.494
• rvis_EVS: 0.08
• rvis_percentile_EVS: 60.09

Haploinsufficiency Scores

• pHI: 0.165
• hipred: N
• hipred_score: 0.248
• ghis: 0.445

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.747

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc25a15

Gene ontology

• Biological process: urea cycle;mitochondrial L-ornithine transmembrane transport
• Cellular component: mitochondrial inner membrane;integral component of membrane
• Molecular function: L-ornithine transmembrane transporter activity