SLC25A15
Basic information
Region (hg38): 13:40789411-40812460
Previous symbols: [ "ORNT1", "HHH" ]
Links
Phenotypes
GenCC
Source:
- ornithine translocase deficiency (Definitive), mode of inheritance: AR
- ornithine translocase deficiency (Strong), mode of inheritance: AR
- ornithine translocase deficiency (Supportive), mode of inheritance: AR
- ornithine translocase deficiency (Definitive), mode of inheritance: AR
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Hyperornithinemia-hyperammonemia-homocitrullinemia syndrome | AR | Biochemical | Dietary (eg, low protein diet,) and medical therapy (eg, with ornithine, citrulline and phenylbutyrate sodium), including during pregnancy, has been reported as beneficial | Biochemical; Gastrointestinal; Neurologic | 5782534; 3091924; 3116497; 3670619; 3106719; 3407856; 2222247; 10369256; 11355015; 11552031; 16940241; 18978333; 19242930; 20574716; 22465082; 25135652 |
ClinVar
This is a list of variants' phenotypes submitted to
- Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome (338 variants)
- not provided (44 variants)
- not specified (17 variants)
- Inborn genetic diseases (11 variants)
- SLC25A15-related condition (4 variants)
- Intellectual disability (1 variants)
- Intellectual disability;Abnormal facial shape (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC25A15 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 90 | 94 | ||||
missense | 11 | 58 | 75 | |||
nonsense | 14 | |||||
start loss | 0 | |||||
frameshift | 15 | 10 | 25 | |||
inframe indel | 1 | |||||
splice donor/acceptor (+/-2bp) | 8 | |||||
splice region ? | 2 | 15 | 2 | 19 | ||
non coding ? | 49 | 39 | 31 | 119 | ||
Total | 27 | 34 | 109 | 131 | 35 |
Highest pathogenic variant AF is 0.0000460
Variants in SLC25A15
This is a list of pathogenic ClinVar variants found in the SLC25A15 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
13-40789413-G-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jun 14, 2016) | ||
13-40789429-C-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jun 14, 2016) | ||
13-40789459-T-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Benign (Jun 29, 2018) | ||
13-40789460-C-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Conflicting classifications of pathogenicity (Feb 01, 2023) | ||
13-40789474-G-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Benign/Likely benign (Aug 31, 2021) | ||
13-40789488-C-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jun 14, 2016) | ||
13-40789566-G-A | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jun 14, 2016) | ||
13-40789613-C-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Mar 30, 2018) | ||
13-40789632-C-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jan 13, 2018) | ||
13-40793115-TGCTGCAGACTTGGACTAATGGTGAACTCTTGCCTCCCCCCAGGGATATGTGGTGCCTGTCATAAGCTCCAGAGAGCTGCCTTCCACAAGACCAGCAGAAGAGTGGGCAAACATGAAATCCAATCCTGCTATCCAGGCTGCCATTGACCTCACAGCGGGGGCTGCAGGTACAGTCATGTGCCTCATCACCATGTTTCTGTCGTTGATGGATGGTGTATCTGATG-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely pathogenic (May 08, 2023) | ||
13-40793142-T-A | not specified | Likely benign (Jun 25, 2016) | ||
13-40793160-A-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Benign/Likely benign (Sep 01, 2021) | ||
13-40793186-G-A | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Jan 12, 2018) | ||
13-40793195-C-T | not specified | Likely benign (Jul 29, 2016) | ||
13-40793227-A-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Pathogenic (Feb 28, 2023) | ||
13-40793237-A-G | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Feb 18, 2022) | ||
13-40793242-G-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Apr 04, 2022) | ||
13-40793244-T-C | not specified • Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely benign (Dec 31, 2023) | ||
13-40793247-C-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely benign (Dec 25, 2020) | ||
13-40793248-C-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome • Cardiac arrhythmia • Hereditary breast ovarian cancer syndrome | Pathogenic (Mar 20, 2024) | ||
13-40793256-CATTGACCTCACAGCGGGGGCTGCAG-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely pathogenic (Jun 08, 2023) | ||
13-40793258-T-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Uncertain significance (Mar 31, 2022) | ||
13-40793268-A-C | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely benign (Jul 15, 2023) | ||
13-40793270-C-T | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Likely pathogenic (-) | ||
13-40793271-G-A | Hyperornithinemia-hyperammonemia-homocitrullinuria syndrome | Conflicting classifications of pathogenicity (Aug 31, 2023) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
SLC25A15 | protein_coding | protein_coding | ENST00000338625 | 6 | 20700 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
3.70e-7 | 0.361 | 125705 | 0 | 43 | 125748 | 0.000171 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 0.101 | 160 | 164 | 0.978 | 0.00000980 | 1946 |
Missense in Polyphen | 61 | 63.187 | 0.96539 | 717 | ||
Synonymous | -0.560 | 70 | 64.3 | 1.09 | 0.00000415 | 606 |
Loss of Function | 0.556 | 11 | 13.2 | 0.835 | 7.24e-7 | 164 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.000408 | 0.000408 |
Ashkenazi Jewish | 0.0000992 | 0.0000992 |
East Asian | 0.000761 | 0.000761 |
Finnish | 0.000139 | 0.000139 |
European (Non-Finnish) | 0.0000615 | 0.0000615 |
Middle Eastern | 0.000761 | 0.000761 |
South Asian | 0.000196 | 0.000196 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Ornithine-citrulline antiporter. Connects the cytosolic and the intramitochondrial reactions of the urea cycle by exchanging cytosolic ornithine with matrix citrulline (PubMed:12807890). The stoichiometry is close to 1:1 (By similarity). {ECO:0000250|UniProtKB:A0A0G2K309, ECO:0000269|PubMed:12807890}.;
- Pathway
- Argininemia;Hyperornithinemia with gyrate atrophy (HOGA);Creatine deficiency, guanidinoacetate methyltransferase deficiency;L-arginine:glycine amidinotransferase deficiency;Hyperornithinemia-hyperammonemia-homocitrullinuria [HHH-syndrome];Guanidinoacetate Methyltransferase Deficiency (GAMT Deficiency);Citrullinemia Type I;Carbamoyl Phosphate Synthetase Deficiency;Argininosuccinic Aciduria;Urea Cycle;Prolinemia Type II;Prolidase Deficiency (PD);Ornithine Transcarbamylase Deficiency (OTC Deficiency);Arginine and Proline Metabolism;Hyperprolinemia Type I;Hyperprolinemia Type II;Ornithine Aminotransferase Deficiency (OAT Deficiency);Arginine: Glycine Amidinotransferase Deficiency (AGAT Deficiency);Metabolism of polyamines;Metabolism of amino acids and derivatives;Metabolism;Urea cycle and metabolism of arginine, proline, glutamate, aspartate and asparagine;Vitamin H (biotin) metabolism;Urea cycle
(Consensus)
Intolerance Scores
- loftool
- 0.494
- rvis_EVS
- 0.08
- rvis_percentile_EVS
- 60.09
Haploinsufficiency Scores
- pHI
- 0.165
- hipred
- N
- hipred_score
- 0.248
- ghis
- 0.445
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.747
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Slc25a15
- Phenotype
Gene ontology
- Biological process
- urea cycle;mitochondrial L-ornithine transmembrane transport
- Cellular component
- mitochondrial inner membrane;integral component of membrane
- Molecular function
- L-ornithine transmembrane transporter activity