SLC26A11

solute carrier family 26 member 11, the group of Solute carrier family 26

Basic information

Region (hg38): 17:80219699-80253509

Links

ENSG00000181045 ∙ NCBI:284129 ∙ OMIM:610117 ∙ HGNC:14471 ∙ Uniprot:Q86WA9 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC26A11 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC26A11 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				1		1
missense			36	3		39
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding				1	5	6
Total	0	0	36	5	5

Variants in SLC26A11

This is a list of pathogenic ClinVar variants found in the SLC26A11 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-80219805-AAGACAGCTGAGACACAGGCTCTGGGGTCGGAAATGAGAGCCAGGAGGGCACCCTGTCTGCAGTCTCTGGGGACCGGAGCACCAGCCCCTCCTCTGGGATCCCCTCCCAAGAGGGATTTGAGATCCGTGGACCCCTGAGCCCTGGCTGGGCAGGGTCAGAGGAGGGTGGGACAGGCGGCACGAGGTAAGTGTAGGGGTGCTGGATGCTGGGGCTCACTCCTCCAGCCTTTGCTGCCCTCTCTGGGGAGACACCCGTGAAGAGTCTGGGGGCGGCACAGAGAGGAGGACGAGAGGGAATGGCAGCGGGGGATACAAGGGCAGGGCACACTAGGGTCAGCATTGACCACGGGTGGGGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACCGAGGAGCAGCAGTGCGTTCCGGGGACGCGCCCGGCAGAGCCCCAGGACTAGC-A		Mucopolysaccharidosis, MPS-III-A	Likely pathogenic (Sep 01, 2022)
17-80220032-T-C			Benign (Jun 28, 2018)
17-80220158-GGAGGAGGCCAGTGGCCACTTCCCCGGGCCACCGCAGGTGGGCGTGGGGGGGCGGCGCCGGCACTCACC-G		Mucopolysaccharidosis, MPS-III-A	Likely pathogenic (Apr 01, 2020)
17-80220203-G-C			Benign (Jul 06, 2018)
17-80220208-G-A		Mucopolysaccharidosis, MPS-III-A	Likely benign (Oct 02, 2022)
17-80220209-G-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (May 13, 2023)
17-80220210-C-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (May 13, 2023)
17-80220212-G-A		Mucopolysaccharidosis, MPS-III-A	Likely benign (Aug 04, 2023)
17-80220213-C-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (Jan 16, 2024)
17-80220216-C-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (Dec 11, 2023)
17-80220217-G-C		Mucopolysaccharidosis, MPS-III-A	Likely benign (Dec 16, 2023)
17-80220218-G-A		Mucopolysaccharidosis, MPS-III-A	Conflicting classifications of pathogenicity (Oct 07, 2023)
17-80220221-C-G		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Aug 16, 2022)
17-80220226-C-A		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Jun 22, 2022)
17-80220226-C-G		Mucopolysaccharidosis, MPS-III-A	Likely pathogenic (Dec 12, 2022)
17-80220226-C-T		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Jul 09, 2021)
17-80220227-G-T		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Jun 04, 2022)
17-80220230-G-A		Mucopolysaccharidosis, MPS-III-A	Likely benign (Aug 10, 2023)
17-80220230-G-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (Nov 04, 2021)
17-80220230-G-GAGC			Uncertain significance (Dec 03, 2013)
17-80220239-T-C		Mucopolysaccharidosis, MPS-III-A	Likely benign (Apr 14, 2022)
17-80220239-T-G		Mucopolysaccharidosis, MPS-III-A	Likely benign (Jan 06, 2022)
17-80220245-C-T		Mucopolysaccharidosis, MPS-III-A	Likely benign (Jun 20, 2022)
17-80220247-G-A		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Nov 03, 2022)
17-80220247-G-C		Mucopolysaccharidosis, MPS-III-A	Uncertain significance (Jan 15, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC26A11	protein_coding	protein_coding	ENST00000361193	16	33802

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
3.01e-19	0.00226	125610	1	137	125748	0.000549

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.205	368	379	0.970	0.0000242	3775
Missense in Polyphen		80	87.282	0.91657		865
Synonymous	-1.70	214	185	1.16	0.0000131	1373
Loss of Function	-0.129	28	27.3	1.03	0.00000116	304

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00160	0.00160
Ashkenazi Jewish	0.00	0.00
East Asian	0.000823	0.000816
Finnish	0.000300	0.000277
European (Non-Finnish)	0.000413	0.000404
Middle Eastern	0.000823	0.000816
South Asian	0.000719	0.000686
Other	0.000671	0.000652

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Exhibits sodium-independent sulfate anion transporter activity that may cooperate with SLC26A2 to mediate DIDS-sensitive sulfate uptake into high endothelial venules endothelial cells (HEVEC). {ECO:0000269|PubMed:12626430}.
• Pathway: Transport of inorganic cations/anions and amino acids/oligopeptides;SLC-mediated transmembrane transport;Transport of small molecules;Methionine and cysteine metabolism;Multifunctional anion exchangers (Consensus)

Recessive Scores

• pRec: 0.109

Intolerance Scores

• loftool: 0.0316
• rvis_EVS: 0.03
• rvis_percentile_EVS: 55.84

Haploinsufficiency Scores

• pHI: 0.0927
• hipred: N
• hipred_score: 0.251
• ghis: 0.484

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.194

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc26a11
• Phenotype: behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); homeostasis/metabolism phenotype

Gene ontology

• Biological process: ion transport;sulfate transport;sulfate transmembrane transport
• Cellular component: nucleoplasm;lysosomal membrane;endoplasmic reticulum;Golgi apparatus;plasma membrane;integral component of plasma membrane;integral component of membrane;intracellular membrane-bounded organelle;extracellular exosome
• Molecular function: secondary active sulfate transmembrane transporter activity;anion transmembrane transporter activity;sulfate transmembrane transporter activity;anion:anion antiporter activity