SLC34A2

solute carrier family 34 member 2, the group of Solute carrier family 34

Basic information

Region (hg38): 4:25648010-25678748

Links

ENSG00000157765 ∙ NCBI:10568 ∙ OMIM:604217 ∙ HGNC:11020 ∙ Uniprot:O95436 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• pulmonary alveolar microlithiasis (Strong), mode of inheritance: AR
• pulmonary alveolar microlithiasis (Supportive), mode of inheritance: AR
• pulmonary alveolar microlithiasis (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Pulmonary alveolar microlithiasis	AR	Pulmonary	Treatment with disodium editronate has been reported as effective	Pulmonary	1485012; 9097354; 9258573; 11287838; 12210357; 12357485; 11956731; 12700375; 16960801; 20425862; 22336687
Individuals with cardiovascular valvular anomalies have been described

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC34A2 gene.

• not provided (58 variants)
• Inborn genetic diseases (25 variants)
• PULMONARY ALVEOLAR MICROLITHIASIS (6 variants)
• not specified (2 variants)
• Hereditary breast ovarian cancer syndrome (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC34A2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				13	9	22
missense		1	35	3	7	46
nonsense	1					1
start loss						0
frameshift	1					1
inframe indel						0
splice donor/acceptor (+/-2bp)		1				1
splice region				3	1	4
non coding				5	7	12
Total	2	2	35	21	23

Highest pathogenic variant AF is 0.00000662

Variants in SLC34A2

This is a list of pathogenic ClinVar variants found in the SLC34A2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
4-25655721-CGGCAGGTAGGCAGTGCCCCGGCGGCGGCTGCGGCAGGCGGTCCTGGAATGTGCGAGGGGCGTGATGACAGCGGCCAGCCTCTTTGCGCAACACCTTCGCCATATATACCCGGGGCGCTGCGCTCCACCTGGCCGCCGCCTCCAGCCCAGCACCTGCGGAGGGAGCGCTGGTGAGTACCGCCGCCGG-C		PULMONARY ALVEOLAR MICROLITHIASIS	Pathogenic (Oct 01, 2006)
4-25662529-C-A		Inborn genetic diseases	Uncertain significance (Feb 15, 2023)
4-25662542-C-T			Benign (Jan 08, 2024)
4-25662554-C-T			Likely benign (Mar 22, 2022)
4-25662561-G-A		Inborn genetic diseases	Uncertain significance (Jan 31, 2024)
4-25662564-G-A			Uncertain significance (Feb 05, 2022)
4-25662599-A-G		SLC34A2-related disorder	Benign (Aug 22, 2023)
4-25662622-G-A			Benign (Jan 23, 2024)
4-25662703-A-G		Hereditary breast ovarian cancer syndrome	Likely pathogenic (Aug 01, 2020)
4-25662705-CA-C		PULMONARY ALVEOLAR MICROLITHIASIS	Pathogenic (Oct 01, 2006)
4-25662722-C-T		Inborn genetic diseases	Uncertain significance (Feb 28, 2023)
4-25662723-C-G		Inborn genetic diseases	Uncertain significance (Oct 14, 2021)
4-25662726-T-C			Benign (Jan 31, 2024)
4-25662738-A-T		Inborn genetic diseases	Uncertain significance (Jan 30, 2024)
4-25662756-C-G		Inborn genetic diseases	Uncertain significance (May 24, 2023)
4-25662790-G-C		SLC34A2-related disorder	Likely benign (Mar 12, 2019)
4-25662803-AACCTACCCACTCT-A		PULMONARY ALVEOLAR MICROLITHIASIS	Pathogenic (Apr 01, 2015)
4-25662818-C-T		PULMONARY ALVEOLAR MICROLITHIASIS	Pathogenic (Oct 01, 2006)
4-25662825-C-T		Inborn genetic diseases	Uncertain significance (May 04, 2023)
4-25662826-G-A			Benign (Jul 17, 2023)
4-25662851-G-T			Likely benign (Oct 17, 2022)
4-25664197-T-C			Likely benign (Jan 31, 2018)
4-25664241-G-T		Inborn genetic diseases	Uncertain significance (Jun 07, 2023)
4-25664247-G-C		Inborn genetic diseases	Uncertain significance (Sep 14, 2023)
4-25664265-T-C		Inborn genetic diseases	Uncertain significance (Sep 14, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC34A2	protein_coding	protein_coding	ENST00000382051	12	23448

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
9.40e-11	0.480	125631	0	117	125748	0.000465

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.145	391	399	0.980	0.0000260	4502
Missense in Polyphen		101	113.93	0.88647		1294
Synonymous	-2.26	215	177	1.22	0.0000134	1412
Loss of Function	1.20	19	25.6	0.743	0.00000121	297

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000755	0.000755
Ashkenazi Jewish	0.00189	0.00189
East Asian	0.000761	0.000761
Finnish	0.00106	0.00106
European (Non-Finnish)	0.000264	0.000229
Middle Eastern	0.000761	0.000761
South Asian	0.000261	0.000261
Other	0.000326	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May be involved in actively transporting phosphate into cells via Na(+) cotransport. It may be the main phosphate transport protein in the intestinal brush border membrane. May have a role in the synthesis of surfactant in lungs' alveoli.
• Disease: DISEASE: Pulmonary alveolar microlithiasis (PALM) [MIM:265100]: Rare disease characterized by the deposition of calcium phosphate microliths throughout the lungs. Most patients are asymptomatic for several years or even for decades and generally, the diagnosis is incidental to clinical investigations unrelated to the disease. Cases with early-onset or rapid progression are rare. A 'sandstorm-appearing' chest roentgenogram is a typical diagnostic finding. The onset of this potentially lethal disease varies from the neonatal period to old age and the disease follows a long- term, progressive course, resulting in a slow deterioration of lung functions. Pulmonary alveolar microlithiasis is a recessive monogenic disease with full penetrance. {ECO:0000269|PubMed:16960801}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=A chromosomal aberration involving SLC34A2 is found in a glioblastoma multiforme cell line U-118MG. Results in the formation of a SLC34A2-ROS1 chimeric protein that retains a constitutive kinase activity. {ECO:0000269|PubMed:12661006}.
• Pathway: Mineral absorption - Homo sapiens (human);Vitamin D Receptor Pathway;Surfactant metabolism;Metabolism of proteins;Transport of inorganic cations/anions and amino acids/oligopeptides;SLC-mediated transmembrane transport;Transport of small molecules;Type II Na+/Pi cotransporters;Sodium-coupled phosphate cotransporters (Consensus)

Intolerance Scores

• loftool: 0.299
• rvis_EVS: 0.16
• rvis_percentile_EVS: 64.92

Haploinsufficiency Scores

• pHI: 0.259
• hipred: N
• hipred_score: 0.318
• ghis: 0.371

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.466

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc34a2
• Phenotype: growth/size/body region phenotype; homeostasis/metabolism phenotype; renal/urinary system phenotype; embryo phenotype; respiratory system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); digestive/alimentary phenotype

Gene ontology

• Biological process: in utero embryonic development;phosphate ion transport;cellular phosphate ion homeostasis;sodium ion transmembrane transport;response to estrogen;cellular protein metabolic process;sodium-dependent phosphate transport
• Cellular component: plasma membrane;integral component of plasma membrane;brush border;integral component of membrane;apical plasma membrane;brush border membrane;vesicle
• Molecular function: sodium:phosphate symporter activity;sodium-dependent phosphate transmembrane transporter activity;sodium ion binding;phosphate ion binding