SLC35A2

solute carrier family 35 member A2, the group of Solute carrier family 35

Basic information

Region (hg38): X:48903180-48911958

Previous symbols: [ "UGALT" ]

Links

ENSG00000102100 ∙ NCBI:7355 ∙ OMIM:314375 ∙ HGNC:11022 ∙ Uniprot:P78381 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• SLC35A2-congenital disorder of glycosylation (Definitive), mode of inheritance: XL
• SLC35A2-congenital disorder of glycosylation (Supportive), mode of inheritance: Unknown
• SLC35A2-congenital disorder of glycosylation (Strong), mode of inheritance: XL
• SLC35A2-congenital disorder of glycosylation (Strong), mode of inheritance: XL
• X-linked complex neurodevelopmental disorder (Definitive), mode of inheritance: XL

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Congenital disorder of glycosylation, type IIm	XL	Allergy/Immunology/Infectious; Hematologic	The condition can include infectious risks (as well as other hematologic anomalies), and antiinfectious prophylaxis and early and aggressive treatment of infections may be beneficial; Awareness of coagulopathies may be beneficial in terms of medical management, especially in situations such as surgery	Allergy/Immunology/Infectious; Craniofacial; Hematologic; Neurologic	23561849; 24115232; 34161696
Hepatic-metabolized medications should be avoided

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC35A2 gene.

• SLC35A2-congenital disorder of glycosylation (21 variants)
• not provided (3 variants)
• non-lesional focal epilepsy (1 variants)
• Inborn genetic diseases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC35A2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				67	4	71
missense	2	10	78	21	16	127
nonsense	6					6
start loss	1	2				3
frameshift	10	1	1	1		13
inframe indel	2	3	4	2	1	12
splice donor/acceptor (+/-2bp)	2					2
splice region			1	6		7
non coding			5	22	5	32
Total	23	16	88	113	26

Variants in SLC35A2

This is a list of pathogenic ClinVar variants found in the SLC35A2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-48903406-C-T			Likely benign (May 01, 2022)
X-48903516-C-T		not specified	Benign (Jul 15, 2024)
X-48904529-TCACCCTACCAGGAAGGGTTCACGTGACACCCAGCTCTAGTCCCACACCCCTCCAGAAGTCTCAGTGACCTGGGAGAAAAGACCATCTCCCAAACCCAGAGGAGCCAGGCCCCGGAGGGTGGCGACTTGGGTCCTGCAGATGCCCAACACCCTCCACCCCAGTCCCCCTCCCTTGTGTCCCCCCATTGCTGCCAGCCCTCACTTCACCAGCACTGACTTTGGCAGAAAGGGCTCCGTGATGAGGTCTCCACGGTGGGAAGACAGCTGCGGTGGTGGTGGCTGCCC-CCTCCCG			Uncertain significance (Sep 21, 2024)
X-48904604-G-T			Uncertain significance (Mar 30, 2023)
X-48904641-C-T			Likely benign (Oct 01, 2022)
X-48904676-C-T		See cases	Uncertain significance (Jul 15, 2020)
X-48904691-TC-T		not specified	Uncertain significance (Jan 31, 2023)
X-48904698-CCCTT-C		not specified	Likely benign (Apr 14, 2016)
X-48904730-C-A		SLC35A2-congenital disorder of glycosylation	Benign (Dec 27, 2023)
X-48904753-G-A		SLC35A2-congenital disorder of glycosylation	Likely benign (Mar 14, 2023)
X-48904762-C-T			Uncertain significance (Jan 19, 2023)
X-48904763-C-T		SLC35A2-congenital disorder of glycosylation	Likely benign (Oct 22, 2023)
X-48904764-G-A		SLC35A2-congenital disorder of glycosylation • Inborn genetic diseases	Benign/Likely benign (Nov 18, 2023)
X-48904779-C-G		SLC35A2-congenital disorder of glycosylation • Inborn genetic diseases	Benign/Likely benign (May 08, 2024)
X-48904779-C-T		SLC35A2-congenital disorder of glycosylation • Inborn genetic diseases	Benign/Likely benign (Sep 01, 2022)
X-48904780-G-A		SLC35A2-congenital disorder of glycosylation	Benign (Aug 08, 2023)
X-48904781-G-A		SLC35A2-congenital disorder of glycosylation	Likely benign (May 05, 2022)
X-48904791-A-G		SLC35A2-congenital disorder of glycosylation	Uncertain significance (Feb 08, 2022)
X-48904796-C-T		SLC35A2-congenital disorder of glycosylation	Likely benign (May 15, 2023)
X-48904797-G-A		SLC35A2-congenital disorder of glycosylation	Benign (Aug 06, 2023)
X-48904797-G-T			Uncertain significance (Jan 30, 2023)
X-48904799-T-A		SLC35A2-congenital disorder of glycosylation	Likely benign (Aug 07, 2023)
X-48904799-T-C		SLC35A2-congenital disorder of glycosylation	Benign (Jan 25, 2024)
X-48904804-G-A		SLC35A2-congenital disorder of glycosylation	Uncertain significance (Dec 03, 2021)
X-48904809-T-C		SLC35A2-congenital disorder of glycosylation • Inborn genetic diseases	Conflicting classifications of pathogenicity (May 15, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC35A2	protein_coding	protein_coding	ENST00000247138	5	8777

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.718	0.279	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.50	76	167	0.456	0.0000141	2464
Missense in Polyphen		5	37.381	0.13376		587
Synonymous	-0.297	85	81.6	1.04	0.00000740	942
Loss of Function	2.38	1	8.48	0.118	6.12e-7	129

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Transports nucleotide sugars from the cytosol into Golgi vesicles where glycosyltransferases function.
• Disease: DISEASE: Congenital disorder of glycosylation 2M (CDG2M) [MIM:300896]: A disorder characterized by developmental delay, hypotonia, ocular anomalies, and brain malformations. Othere more variable clinical features included seizures, hypsarrhythmia, poor feeding, microcephaly, recurrent infections, dysmorphic features, shortened limbs, and coagulation defects. Congenital disorders of glycosylation are caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins and a wide variety of clinical features. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. {ECO:0000269|PubMed:23561849, ECO:0000269|PubMed:24115232}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: GLUT-1 deficiency syndrome;Congenital disorder of glycosylation CDG-IId;Lactose Synthesis;Transport of vitamins, nucleosides, and related molecules;SLC-mediated transmembrane transport;Transport of small molecules;Galactose metabolism;O-Glycan biosynthesis;Transport of nucleotide sugars (Consensus)

Recessive Scores

• pRec: 0.422

Intolerance Scores

• loftool: 0.240
• rvis_EVS: -0.16
• rvis_percentile_EVS: 41.64

Haploinsufficiency Scores

• pHI: 0.222
• hipred: Y
• hipred_score: 0.516
• ghis: 0.515

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: K
• gene_indispensability_pred: E
• gene_indispensability_score: 0.667

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc35a2

Gene ontology

• Biological process: galactose metabolic process;carbohydrate transport;UDP-galactose transmembrane transport
• Cellular component: Golgi membrane;nucleus;endoplasmic reticulum;Golgi apparatus;integral component of Golgi membrane
• Molecular function: UDP-galactose transmembrane transporter activity