SLC6A3

solute carrier family 6 member 3, the group of Solute carrier family 6

Basic information

Region (hg38): 5:1392794-1445440

Previous symbols: [ "DAT1" ]

Links

ENSG00000142319 ∙ NCBI:6531 ∙ OMIM:126455 ∙ HGNC:11049 ∙ Uniprot:Q01959 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• classic dopamine transporter deficiency syndrome (Moderate), mode of inheritance: AR
• classic dopamine transporter deficiency syndrome (Definitive), mode of inheritance: AR
• parkinsonism-dystonia, infantile (Supportive), mode of inheritance: AR
• classic dopamine transporter deficiency syndrome (Strong), mode of inheritance: AR
• SLC6A3-related dopamine transporter deficiency syndrome (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Parkinsonism-dystonia, infantile 1	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	19478460; 22279524
Described patients demonstrated poor clinical responses to multiple therapeutic agents

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SLC6A3 gene.

• Classic dopamine transporter deficiency syndrome (2 variants)
• Parkinsonism-dystonia, infantile (2 variants)
• not provided (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SLC6A3 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			3	120	11	134
missense		2	118	5		125
nonsense	2					2
start loss			1			1
frameshift	1	1				2
inframe indel						0
splice donor/acceptor (+/-2bp)	1	2				3
splice region		1	11	22	1	35
non coding			3	89	67	159
Total	4	5	125	214	78

Variants in SLC6A3

This is a list of pathogenic ClinVar variants found in the SLC6A3 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
5-1393745-TGTGGGGGCCCTGCATGCGTCCTGGGGTAGTACACGCTCCA-T		Schizophrenia	Uncertain risk allele (-)
5-1393899-T-TGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACACGCTCCTGTGGGGGCCCTGCATGCGTCCGGGGATAGGACAC		Nicotine dependence, protection against	protective (Jan 01, 1999)
5-1394407-C-T			Benign (Jul 15, 2020)
5-1394407-CGGGAGCA-C			Likely benign (Dec 01, 2018)
5-1394485-C-G			Benign (Jul 05, 2018)
5-1394500-C-T			Likely benign (Aug 17, 2018)
5-1394545-G-A			Likely benign (Oct 27, 2018)
5-1394699-C-T			Benign (Sep 21, 2018)
5-1394700-A-G		Classic dopamine transporter deficiency syndrome	Benign (Jul 15, 2021)
5-1394741-C-G		Parkinsonism-dystonia, infantile • Inborn genetic diseases	Conflicting classifications of pathogenicity (Jan 13, 2024)
5-1394754-C-T		Parkinsonism-dystonia, infantile	Likely benign (Dec 30, 2023)
5-1394755-G-A		Parkinsonism-dystonia, infantile	Uncertain significance (Apr 30, 2021)
5-1394760-T-TGGAAA			Likely benign (Mar 27, 2018)
5-1394766-G-T		Parkinsonism-dystonia, infantile	Likely benign (Mar 03, 2021)
5-1394806-TTAAGAGCAGCTGAAGGTGGC-T			Likely benign (Aug 25, 2018)
5-1394962-C-T			Benign (Aug 14, 2018)
5-1394998-C-T			Likely benign (Oct 02, 2018)
5-1395016-G-A			Benign (Feb 16, 2019)
5-1400635-G-A			Benign (Sep 04, 2018)
5-1400730-C-T			Likely benign (Oct 02, 2018)
5-1400816-A-ATCTACACCAGCCCTG			Benign (Aug 17, 2018)
5-1400883-CGA-C			Likely benign (Nov 15, 2018)
5-1400900-G-A		Parkinsonism-dystonia, infantile	Likely benign (Oct 13, 2022)
5-1400900-GGACCTC-G		Parkinsonism-dystonia, infantile	Likely benign (Feb 13, 2023)
5-1400906-C-T		Parkinsonism-dystonia, infantile	Benign (Dec 11, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SLC6A3	protein_coding	protein_coding	ENST00000270349	14	52637

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.998	0.00242	125726	0	22	125748	0.0000875

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.29	249	374	0.666	0.0000258	4017
Missense in Polyphen		52	122.52	0.42443		1346
Synonymous	-1.92	202	170	1.19	0.0000141	1271
Loss of Function	4.65	3	30.9	0.0972	0.00000164	320

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000289	0.0000289
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.000106	0.0000967
Middle Eastern	0.00	0.00
South Asian	0.000327	0.000327
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Amine transporter. Terminates the action of dopamine by its high affinity sodium-dependent reuptake into presynaptic terminals. {ECO:0000269|PubMed:1406597, ECO:0000269|PubMed:15505207, ECO:0000269|PubMed:8302271}.
• Pathway: Dopaminergic synapse - Homo sapiens (human);Amphetamine addiction - Homo sapiens (human);Parkinson,s disease - Homo sapiens (human);Alcoholism - Homo sapiens (human);Cocaine addiction - Homo sapiens (human);Levomethadyl Acetate Action Action Pathway;Fluoxetine Action Pathway;Citalopram Action Pathway;Escitalopram Action Pathway;Imipramine Action Pathway;Desipramine Action Pathway;Levallorphan Action Pathway;Dimethylthiambutene Action Pathway;Ethylmorphine Action Pathway;Pentazocine Action Pathway;Naltrexone Action Pathway;Buprenorphine Action Pathway;Alvimopan Action Pathway;Naloxone Action Pathway;Dihydromorphine Action Pathway;Nicotine Action Pathway;Nalbuphine Action Pathway;Ketobemidone Action Pathway;Lidocaine (Local Anaesthetic) Action Pathway;Mepivacaine Action Pathway;Chloroprocaine Action Pathway;Cocaine Action Pathway;Dibucaine Action Pathway;Levobupivacaine Action Pathway;Benzocaine Action Pathway;Bupivacaine Action Pathway;Levorphanol Action Pathway;Propoxyphene Action Pathway;Tramadol Action Action Pathway;Diphenoxylate Action Pathway;Anileridine Action Pathway;Methadone Action Pathway;Oxycodone Action Pathway;Oxybuprocaine Action Pathway;Prilocaine Action Pathway;Procaine Action Pathway;Proparacaine Action Pathway;Ropivacaine Action Pathway;Codeine Action Pathway;Morphine Action Pathway;Heroin Action Pathway;Alfentanil Action Pathway;Oxymorphone Action Pathway;Hydrocodone Action Pathway;Hydromorphone Action Pathway;Sufentanil Action Pathway;Remifentanil Action Pathway;Fentanyl Action Pathway;Carfentanil Action Pathway;3-Methylthiofentanyl Action Pathway;Methadyl Acetate Action Pathway;Dezocine Action Pathway;Parkinsons Disease Pathway;Dopaminergic Neurogenesis;Nuclear Receptors Meta-Pathway;NRF2 pathway;Monoamine Transport;Amine compound SLC transporters;Tyrosine metabolism;Transport of bile salts and organic acids, metal ions and amine compounds;SLC-mediated transmembrane transport;Transport of small molecules;Neuronal System;Na+/Cl- dependent neurotransmitter transporters;Dopamine clearance from the synaptic cleft;Neurotransmitter clearance;Transmission across Chemical Synapses;Alpha-synuclein signaling (Consensus)

Recessive Scores

• pRec: 0.372

Intolerance Scores

• loftool: 0.209
• rvis_EVS: -1.53
• rvis_percentile_EVS: 3.39

Haploinsufficiency Scores

• pHI: 0.230
• hipred: Y
• hipred_score: 0.837
• ghis: 0.460

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.823

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Slc6a3
• Phenotype: integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; endocrine/exocrine gland phenotype; taste/olfaction phenotype; muscle phenotype; craniofacial phenotype; cellular phenotype; homeostasis/metabolism phenotype; immune system phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; hematopoietic system phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan)

Zebrafish Information Network

• Gene name: slc6a3
• Affected structure: whole organism
• Phenotype tag: abnormal
• Phenotype quality: morphology

Gene ontology

• Biological process: neurotransmitter uptake;aging;lactation;sensory perception of smell;locomotory behavior;response to iron ion;monoamine transport;dopamine transport;adenohypophysis development;response to nicotine;positive regulation of multicellular organism growth;regulation of dopamine metabolic process;neurotransmitter biosynthetic process;response to cocaine;dopamine biosynthetic process;dopamine catabolic process;response to ethanol;response to cAMP;transmembrane transport;prepulse inhibition;dopamine uptake
• Cellular component: cytoplasm;plasma membrane;cell surface;integral component of membrane;flotillin complex;axon;neuron projection;neuronal cell body;membrane raft;dopaminergic synapse;integral component of postsynaptic membrane;integral component of presynaptic membrane
• Molecular function: protease binding;signaling receptor binding;neurotransmitter:sodium symporter activity;dopamine:sodium symporter activity;protein binding;monoamine transmembrane transporter activity;dopamine binding;protein-containing complex binding;metal ion binding;protein N-terminus binding;protein phosphatase 2A binding