SNX27

sorting nexin 27, the group of Sorting nexins|PDZ domain containing

Basic information

Region (hg38): 1:151612006-151699091

Links

ENSG00000143376 ∙ NCBI:81609 ∙ OMIM:611541 ∙ HGNC:20073 ∙ Uniprot:Q96L92 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the SNX27 gene.

• Severe myoclonic epilepsy in infancy (13 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the SNX27 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			4	117	2	123
missense		1	155	7	1	164
nonsense	7	1				8
start loss			1			1
frameshift	6	1	2			9
inframe indel			4		1	5
splice donor/acceptor (+/-2bp)			1	4	2	7
splice region			6	22	5	33
non coding			1	49	4	54
Total	13	3	168	177	10

Highest pathogenic variant AF is 0.00000658

Variants in SNX27

This is a list of pathogenic ClinVar variants found in the SNX27 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
1-151612201-G-GAAGGGACATAGTAATTTCCGTTGTTTCATGTTCTAATCTGTATATGGAAGTTTCATTGACAAGCTCATAAAATGGCAGTTCCACACAACTTTGGGAAGCAATAATTTACATTATTAAAATTATCCTGAAA		Severe myoclonic epilepsy in infancy	Uncertain significance (Jun 29, 2021)
1-151612207-G-T		Severe myoclonic epilepsy in infancy	Likely benign (Jul 26, 2022)
1-151612215-A-C		Severe myoclonic epilepsy in infancy	Uncertain significance (Sep 24, 2021)
1-151612216-C-G		Severe myoclonic epilepsy in infancy • Inborn genetic diseases	Uncertain significance (May 20, 2024)
1-151612216-C-T		Severe myoclonic epilepsy in infancy	Likely benign (Mar 24, 2018)
1-151612217-G-C		Inborn genetic diseases • Severe myoclonic epilepsy in infancy	Uncertain significance (Sep 15, 2022)
1-151612218-G-A		Severe myoclonic epilepsy in infancy	Uncertain significance (Jun 02, 2022)
1-151612218-G-T		Severe myoclonic epilepsy in infancy • Inborn genetic diseases	Uncertain significance (Aug 30, 2023)
1-151612219-G-A		Severe myoclonic epilepsy in infancy	Benign (Jan 25, 2024)
1-151612220-G-A		Severe myoclonic epilepsy in infancy	Uncertain significance (Sep 08, 2020)
1-151612221-A-G		Inborn genetic diseases	Uncertain significance (Apr 01, 2024)
1-151612228-T-G		Severe myoclonic epilepsy in infancy	Uncertain significance (Jul 02, 2022)
1-151612232-C-T		Inborn genetic diseases	Uncertain significance (May 31, 2023)
1-151612234-C-T		Severe myoclonic epilepsy in infancy	Likely benign (Nov 08, 2021)
1-151612241-C-A		Severe myoclonic epilepsy in infancy	Uncertain significance (Aug 28, 2021)
1-151612241-C-T		Severe myoclonic epilepsy in infancy • Inborn genetic diseases	Uncertain significance (Mar 31, 2024)
1-151612242-C-T		Severe myoclonic epilepsy in infancy • Inborn genetic diseases	Uncertain significance (May 18, 2022)
1-151612246-C-G		Inborn genetic diseases	Uncertain significance (Jan 26, 2022)
1-151612250-A-C		Severe myoclonic epilepsy in infancy	Uncertain significance (Aug 24, 2021)
1-151612254-G-C		Severe myoclonic epilepsy in infancy	Uncertain significance (Jun 13, 2022)
1-151612257-G-A		Severe myoclonic epilepsy in infancy • Inborn genetic diseases	Uncertain significance (Aug 31, 2022)
1-151612258-T-TGGC		Severe myoclonic epilepsy in infancy	Benign (Jan 29, 2024)
1-151612258-T-TGGCGGC		Severe myoclonic epilepsy in infancy	Uncertain significance (Jul 25, 2022)
1-151612260-G-T		Inborn genetic diseases	Uncertain significance (Jan 03, 2024)
1-151612270-C-T		Severe myoclonic epilepsy in infancy	Likely benign (Dec 31, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
SNX27	protein_coding	protein_coding	ENST00000368843	12	87027

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.00	0.000229	125731	0	17	125748	0.0000676

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.17	179	282	0.636	0.0000152	3433
Missense in Polyphen		67	114.26	0.58636		1337
Synonymous	1.58	92	113	0.811	0.00000666	996
Loss of Function	4.98	2	32.8	0.0610	0.00000205	345

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000148	0.000148
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.0000440	0.0000439
Middle Eastern	0.00	0.00
South Asian	0.000229	0.000229
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Involved in the retrograde transport from endosome to plasma membrane, a trafficking pathway that promotes the recycling of internalized transmembrane proteins. Following internalization, endocytosed transmembrane proteins are delivered to early endosomes and recycled to the plasma membrane instead of being degraded in lysosomes. SNX27 specifically binds and directs sorting of a subset of transmembrane proteins containing a PDZ- binding motif at the C-terminus: following interaction with target transmembrane proteins, associates with the retromer complex, preventing entry into the lysosomal pathway, and promotes retromer-tubule based plasma membrane recycling. SNX27 also binds with the WASH complex. Interacts with membranes containing phosphatidylinositol-3-phosphate (PtdIns(3P)). May participate in establishment of natural killer cell polarity. Recruits CYTIP to early endosomes. {ECO:0000269|PubMed:17351151, ECO:0000269|PubMed:20733053, ECO:0000269|PubMed:21300787, ECO:0000269|PubMed:21303929, ECO:0000269|PubMed:21602791, ECO:0000269|PubMed:21926430, ECO:0000269|PubMed:22411990, ECO:0000269|PubMed:23563491}.

Recessive Scores

• pRec: 0.0851

Intolerance Scores

• loftool: 0.118
• rvis_EVS: 0.06
• rvis_percentile_EVS: 58.53

Haploinsufficiency Scores

• pHI: 0.155
• hipred: Y
• hipred_score: 0.653
• ghis: 0.484

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.890

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Snx27
• Phenotype: growth/size/body region phenotype; cellular phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); liver/biliary system phenotype; immune system phenotype; digestive/alimentary phenotype

Gene ontology

• Biological process: establishment of natural killer cell polarity;intracellular protein transport;signal transduction;endosome to lysosome transport;endosomal transport;retrograde transport, endosome to plasma membrane
• Cellular component: immunological synapse;nucleoplasm;endosome;early endosome;cytosol;retromer complex;early endosome membrane;WASH complex
• Molecular function: protein binding;phosphatidylinositol-3-phosphate binding;phosphatidylinositol binding