TGFBR2
transforming growth factor beta receptor 2, the group of Type 2 receptor serine/threonine kinases
Basic information
Region (hg38): 3:30606478-30694249
Previous symbols: [ "MFS2" ]
Links
Phenotypes
GenCC
Source:
- Rienhoff syndrome (Definitive), mode of inheritance: AD
- Loeys-Dietz syndrome 2 (Strong), mode of inheritance: AD
- Loeys-Dietz syndrome 2 (Strong), mode of inheritance: AD
- Loeys-Dietz syndrome 2 (Definitive), mode of inheritance: AD
- Loeys-Dietz syndrome (Supportive), mode of inheritance: AD
- familial thoracic aortic aneurysm and aortic dissection (Supportive), mode of inheritance: AD
- Loeys-Dietz syndrome 2 (Strong), mode of inheritance: AD
- familial thoracic aortic aneurysm and aortic dissection (Definitive), mode of inheritance: AD
- Loeys-Dietz syndrome 2 (Definitive), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Loeys-Dietz syndrome, type 2 | AD | Cardiovascular; Obstetric | Medical management to decrease risk of vascular events is warranted, including avoidance of certain types of activities such as contact sports; Specific surveillance for surgical considerations related to issues such as aneurysms and cervical spine instability, other issues include subacute bacterial endocarditis prophylaxis with dental work; Precautions during pregnancy may be warranted due to the potential of complications including uterine rupture | Cardiovascular; Craniofacial; Dermatologic; Musculoskeletal; Obstetric | 15235604; 16027248; 15731757; 16928994; 16251899; 19006214; 19542084; 19996017; 24344637 |
| An increased risk of colorectal cancer has been reported |
ClinVar
This is a list of variants' phenotypes submitted to
- Familial thoracic aortic aneurysm and aortic dissection (27 variants)
- Loeys-Dietz syndrome 2 (10 variants)
- not provided (7 variants)
- Loeys-Dietz syndrome (4 variants)
- Cardiovascular phenotype (4 variants)
- Malignant tumor of esophagus (2 variants)
- Colorectal cancer, hereditary nonpolyposis, type 6 (1 variants)
- Malignant tumor of esophagus;Loeys-Dietz syndrome 2;Colorectal cancer, hereditary nonpolyposis, type 6 (1 variants)
- TGFBR2-related disorder (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the TGFBR2 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 237 | 246 | ||||
| missense | 32 | 53 | 394 | 488 | ||
| nonsense | 18 | |||||
| start loss | 0 | |||||
| frameshift | 12 | 16 | ||||
| inframe indel | 10 | 11 | ||||
| splice donor/acceptor (+/-2bp) | 7 | |||||
| splice region | 1 | 17 | 16 | 2 | 36 | |
| non coding | 50 | 76 | 34 | 160 | ||
| Total | 36 | 67 | 482 | 322 | 39 |
Variants in TGFBR2
This is a list of pathogenic ClinVar variants found in the TGFBR2 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 3-30606496-C-T | Loeys-Dietz syndrome 2 • Diabetic retinopathy | Conflicting classifications of pathogenicity (Jan 12, 2018) | ||
| 3-30606513-A-C | Marfan syndrome • Loeys-Dietz syndrome • Loeys-Dietz syndrome 2 • Colorectal cancer, hereditary nonpolyposis, type 6;Malignant tumor of esophagus;Loeys-Dietz syndrome 2 • Diabetic retinopathy | Conflicting classifications of pathogenicity (Sep 14, 2021) | ||
| 3-30606540-C-A | Familial thoracic aortic aneurysm and aortic dissection • Loeys-Dietz syndrome • Marfan syndrome | Uncertain significance (Jun 14, 2016) | ||
| 3-30606540-C-T | Diabetic retinopathy | Uncertain risk allele (-) | ||
| 3-30606547-T-A | Familial thoracic aortic aneurysm and aortic dissection • Loeys-Dietz syndrome 2;Malignant tumor of esophagus;Colorectal cancer, hereditary nonpolyposis, type 6 • Diabetic retinopathy | Uncertain significance/Uncertain risk allele (Oct 04, 2021) | ||
| 3-30606567-TCCCCCGCAGCGCTGAGTTGAAGTTGAGTGAGTCACTCGCGCGCACGGAGCGACGACAC-T | Familial thoracic aortic aneurysm and aortic dissection | Uncertain significance (Oct 25, 2019) | ||
| 3-30606568-CCCCCGCAGCGCTGAGTTGAAGTTGAGTGAGTCACTCGCGCGCACGGAGCGACGACACCCCCGCGCGTGCACCCGCTCGGGACAGGAGCCGGACTCCTGTGCAGCTTCCCTCGGCCGCCGGGGGCCTCCCCGCGCCTCGCCGGCCTCCAGGCCCCCTCCTGGCTGGCGAGCGGGCGCCACATCTGGCCCGCACATCTGCGCTGCCGGCCCGGCGCGGGGTCCGGAGAGGGCGCGGCGCGGAGGCGCAGCCAGGGGTCCGGGAAGGCGCCGTCCGCTGCGCTGGGGGCTCGGTCT-C | Familial thoracic aortic aneurysm and aortic dissection | Uncertain significance (Apr 14, 2022) | ||
| 3-30606577-C-T | Familial thoracic aortic aneurysm and aortic dissection • Loeys-Dietz syndrome • Marfan syndrome • Colorectal cancer, hereditary nonpolyposis, type 6;Malignant tumor of esophagus;Loeys-Dietz syndrome 2 • Diabetic retinopathy | Conflicting classifications of pathogenicity (Aug 24, 2021) | ||
| 3-30606582-A-G | Familial thoracic aortic aneurysm and aortic dissection • Marfan syndrome • Loeys-Dietz syndrome • Diabetic retinopathy | Likely benign (Jun 26, 2018) | ||
| 3-30606635-T-G | Familial thoracic aortic aneurysm and aortic dissection • Marfan syndrome • Loeys-Dietz syndrome 2 • Diabetic retinopathy | Uncertain significance/Uncertain risk allele (Jan 12, 2018) | ||
| 3-30606656-C-A | Marfan syndrome • Familial thoracic aortic aneurysm and aortic dissection • Loeys-Dietz syndrome • Diabetic retinopathy | Uncertain significance/Uncertain risk allele (Jun 14, 2016) | ||
| 3-30606689-G-A | Loeys-Dietz syndrome 2 | Uncertain significance (Jan 13, 2018) | ||
| 3-30606689-G-C | Diabetic retinopathy | Uncertain risk allele (-) | ||
| 3-30606691-G-A | Loeys-Dietz syndrome • Marfan syndrome • Loeys-Dietz syndrome 2 • Malignant tumor of esophagus;Loeys-Dietz syndrome 2;Colorectal cancer, hereditary nonpolyposis, type 6 • Diabetic retinopathy | Uncertain significance/Uncertain risk allele (Aug 23, 2021) | ||
| 3-30606756-C-G | Loeys-Dietz syndrome 2 • Familial thoracic aortic aneurysm and aortic dissection • Loeys-Dietz syndrome • Diabetic retinopathy | Benign/Likely benign (Jun 14, 2018) | ||
| 3-30606762-T-G | Loeys-Dietz syndrome 2 • Diabetic retinopathy | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 3-30606767-G-A | Marfan syndrome • Loeys-Dietz syndrome • Familial thoracic aortic aneurysm and aortic dissection • Diabetic retinopathy | Conflicting classifications of pathogenicity (Jun 14, 2016) | ||
| 3-30606818-A-G | TGFBR2-related disorder | Likely benign (Aug 09, 2021) | ||
| 3-30606825-C-G | Diabetic retinopathy | Conflicting classifications of pathogenicity (Dec 01, 2020) | ||
| 3-30606853-G-A | not specified • Diabetic retinopathy | Likely benign (Oct 26, 2017) | ||
| 3-30606857-G-C | Diabetic retinopathy | Uncertain significance/Uncertain risk allele (Jan 17, 2018) | ||
| 3-30606858-G-A | Loeys-Dietz syndrome 2 | Uncertain significance (Jan 12, 2018) | ||
| 3-30606858-G-T | Diabetic retinopathy | Uncertain risk allele (-) | ||
| 3-30606866-C-A | Marfan syndrome • Loeys-Dietz syndrome 2 • Loeys-Dietz syndrome • Diabetic retinopathy | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 3-30606869-G-C | Familial thoracic aortic aneurysm and aortic dissection | Uncertain significance (Mar 28, 2023) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| TGFBR2 | protein_coding | protein_coding | ENST00000359013 | 8 | 87641 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.125 | 0.874 | 125736 | 0 | 11 | 125747 | 0.0000437 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 2.24 | 215 | 330 | 0.652 | 0.0000190 | 3939 |
| Missense in Polyphen | 51 | 113.56 | 0.44909 | 1387 | ||
| Synonymous | -0.598 | 140 | 131 | 1.07 | 0.00000793 | 1118 |
| Loss of Function | 3.26 | 6 | 22.8 | 0.263 | 0.00000114 | 281 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.000123 | 0.000123 |
| Ashkenazi Jewish | 0.0000994 | 0.0000992 |
| East Asian | 0.000109 | 0.000109 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000442 | 0.0000439 |
| Middle Eastern | 0.000109 | 0.000109 |
| South Asian | 0.0000327 | 0.0000327 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Transmembrane serine/threonine kinase forming with the TGF-beta type I serine/threonine kinase receptor, TGFBR1, the non- promiscuous receptor for the TGF-beta cytokines TGFB1, TGFB2 and TGFB3. Transduces the TGFB1, TGFB2 and TGFB3 signal from the cell surface to the cytoplasm and is thus regulating a plethora of physiological and pathological processes including cell cycle arrest in epithelial and hematopoietic cells, control of mesenchymal cell proliferation and differentiation, wound healing, extracellular matrix production, immunosuppression and carcinogenesis. The formation of the receptor complex composed of 2 TGFBR1 and 2 TGFBR2 molecules symmetrically bound to the cytokine dimer results in the phosphorylation and the activation of TGFRB1 by the constitutively active TGFBR2. Activated TGFBR1 phosphorylates SMAD2 which dissociates from the receptor and interacts with SMAD4. The SMAD2-SMAD4 complex is subsequently translocated to the nucleus where it modulates the transcription of the TGF-beta-regulated genes. This constitutes the canonical SMAD-dependent TGF-beta signaling cascade. Also involved in non- canonical, SMAD-independent TGF-beta signaling pathways. {ECO:0000269|PubMed:7774578}.;
- Disease
- DISEASE: Hereditary non-polyposis colorectal cancer 6 (HNPCC6) [MIM:614331]: An autosomal dominant disease associated with marked increase in cancer susceptibility. It is characterized by a familial predisposition to early-onset colorectal carcinoma (CRC) and extra-colonic tumors of the gastrointestinal, urological and female reproductive tracts. HNPCC is reported to be the most common form of inherited colorectal cancer in the Western world. Clinically, HNPCC is often divided into two subgroups. Type I is characterized by hereditary predisposition to colorectal cancer, a young age of onset, and carcinoma observed in the proximal colon. Type II is characterized by increased risk for cancers in certain tissues such as the uterus, ovary, breast, stomach, small intestine, skin, and larynx in addition to the colon. Diagnosis of classical HNPCC is based on the Amsterdam criteria: 3 or more relatives affected by colorectal cancer, one a first degree relative of the other two; 2 or more generation affected; 1 or more colorectal cancers presenting before 50 years of age; exclusion of hereditary polyposis syndromes. The term 'suspected HNPCC' or 'incomplete HNPCC' can be used to describe families who do not or only partially fulfill the Amsterdam criteria, but in whom a genetic basis for colon cancer is strongly suspected. {ECO:0000269|PubMed:9590282}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Esophageal cancer (ESCR) [MIM:133239]: A malignancy of the esophagus. The most common types are esophageal squamous cell carcinoma and adenocarcinoma. Cancer of the esophagus remains a devastating disease because it is usually not detected until it has progressed to an advanced incurable stage. {ECO:0000269|PubMed:10789724}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Loeys-Dietz syndrome 2 (LDS2) [MIM:610168]: An aortic aneurysm syndrome with widespread systemic involvement, characterized by arterial tortuosity and aneurysms, hypertelorism, and bifid uvula or cleft palate. Physical findings include prominent joint laxity, easy bruising, wide and atrophic scars, velvety and translucent skin with easily visible veins, spontaneous rupture of the spleen or bowel, and catastrophic complications of pregnancy, including rupture of the gravid uterus and the arteries, either during pregnancy or in the immediate postpartum period. Some patients have craniosynostosis, exotropy, micrognathia and retrognathia, structural brain abnormalities, and intellectual deficit. {ECO:0000269|PubMed:15235604, ECO:0000269|PubMed:15731757, ECO:0000269|PubMed:16027248, ECO:0000269|PubMed:16251899, ECO:0000269|PubMed:19533785, ECO:0000269|PubMed:19883511, ECO:0000269|PubMed:20101701, ECO:0000269|PubMed:20358619, ECO:0000269|PubMed:21949523, ECO:0000269|PubMed:22113417}. Note=The disease is caused by mutations affecting the gene represented in this entry. TGFBR2 mutations Cys-460 and His-460 have been reported to be associated with thoracic aortic aneurysms and dissection (TAAD). This phenotype, also known as thoracic aortic aneurysms type 3 (AAT3), is distinguised from LDS2 by having aneurysms restricted to thoracic aorta. As individuals carrying these mutations also exhibit descending aortic disease and aneurysms of other arteries (PubMed:16027248), they have been considered as LDS2 by the OMIM resource. {ECO:0000269|PubMed:16027248}.;
- Pathway
- Chronic myeloid leukemia - Homo sapiens (human);Gastric cancer - Homo sapiens (human);Relaxin signaling pathway - Homo sapiens (human);TGF-beta signaling pathway - Homo sapiens (human);Adherens junction - Homo sapiens (human);AGE-RAGE signaling pathway in diabetic complications - Homo sapiens (human);Endocytosis - Homo sapiens (human);FoxO signaling pathway - Homo sapiens (human);HTLV-I infection - Homo sapiens (human);Hepatocellular carcinoma - Homo sapiens (human);Hippo signaling pathway - Homo sapiens (human);Chagas disease (American trypanosomiasis) - Homo sapiens (human);Th17 cell differentiation - Homo sapiens (human);MAPK signaling pathway - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Transcriptional misregulation in cancer - Homo sapiens (human);Osteoclast differentiation - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);Cellular senescence - Homo sapiens (human);Pancreatic cancer - Homo sapiens (human);Colorectal cancer - Homo sapiens (human);EGF-Core;TGF-Core;miR-targeted genes in adipocytes - TarBase;miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;miR-targeted genes in muscle cell - TarBase;miR-targeted genes in squamous cell - TarBase;Extracellular vesicle-mediated signaling in recipient cells;Nuclear Receptors Meta-Pathway;NRF2 pathway;TGF-beta Signaling Pathway;Hypothesized Pathways in Pathogenesis of Cardiovascular Disease;MAPK Signaling Pathway;Canonical and Non-Canonical TGF-B signaling;Chromosomal and microsatellite instability in colorectal cancer;EMT transition in Colorectal Cancer;TGF-beta Receptor Signaling;Disease;Signal Transduction;alk in cardiac myocytes;nfkb activation by nontypeable hemophilus influenzae;ctcf: first multivalent nuclear factor;Post-translational protein modification;Metabolism of proteins;TGF-beta super family signaling pathway canonical;IL-7 signaling;Beta3 integrin cell surface interactions;UCH proteinases;TGF_beta_Receptor;tgf beta signaling pathway;JAK STAT pathway and regulation;Deubiquitination;EPO signaling;TGFBR2 Kinase Domain Mutants in Cancer;TGF-beta signaling TAK1;SMAD2/3 Phosphorylation Motif Mutants in Cancer;SMAD2/3 MH2 Domain Mutants in Cancer;Loss of Function of SMAD2/3 in Cancer;Loss of Function of TGFBR2 in Cancer;TGFBR1 KD Mutants in Cancer;Loss of Function of TGFBR1 in Cancer;Signaling by TGF-beta Receptor Complex in Cancer;Signaling by TGF-beta Receptor Complex;BMP2 signaling TGF-beta MV;VEGF;Signaling by TGF-beta family members;Downregulation of TGF-beta receptor signaling;TGF-beta receptor signaling activates SMADs;ALK1 signaling events;Diseases of signal transduction;Glypican 1 network;TGF-beta receptor signaling in EMT (epithelial to mesenchymal transition);TGF-beta receptor signaling;Integrins in angiogenesis
(Consensus)
Recessive Scores
- pRec
- 0.814
Intolerance Scores
- loftool
- 0.0601
- rvis_EVS
- -0.05
- rvis_percentile_EVS
- 50.34
Haploinsufficiency Scores
- pHI
- 0.976
- hipred
- Y
- hipred_score
- 0.756
- ghis
- 0.572
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- S
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 1.00
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Tgfbr2
- Phenotype
- homeostasis/metabolism phenotype; cellular phenotype; muscle phenotype; craniofacial phenotype; growth/size/body region phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); endocrine/exocrine gland phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); respiratory system phenotype; liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); immune system phenotype; skeleton phenotype; digestive/alimentary phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; pigmentation phenotype; neoplasm; embryo phenotype;
Zebrafish Information Network
- Gene name
- tgfbr2b
- Affected structure
- hematopoietic multipotent progenitor cell
- Phenotype tag
- abnormal
- Phenotype quality
- decreased amount
Gene ontology
- Biological process
- blood vessel development;branching involved in blood vessel morphogenesis;vasculogenesis;response to hypoxia;in utero embryonic development;heart looping;positive regulation of mesenchymal cell proliferation;lens development in camera-type eye;positive regulation of tolerance induction to self antigen;positive regulation of B cell tolerance induction;positive regulation of T cell tolerance induction;outflow tract septum morphogenesis;membranous septum morphogenesis;outflow tract morphogenesis;atrioventricular valve morphogenesis;tricuspid valve morphogenesis;cardiac left ventricle morphogenesis;endocardial cushion fusion;growth plate cartilage chondrocyte growth;protein phosphorylation;receptor-mediated endocytosis;apoptotic process;transforming growth factor beta receptor signaling pathway;common-partner SMAD protein phosphorylation;Notch signaling pathway;smoothened signaling pathway;gastrulation;pattern specification process;brain development;heart development;embryo implantation;aging;response to nutrient;positive regulation of cell population proliferation;response to mechanical stimulus;response to glucose;regulation of gene expression;positive regulation of epithelial cell migration;positive regulation of epithelial to mesenchymal transition;peptidyl-serine phosphorylation;peptidyl-threonine phosphorylation;negative regulation of transforming growth factor beta receptor signaling pathway;animal organ regeneration;activation of protein kinase activity;embryonic hemopoiesis;wound healing;regulation of cell population proliferation;response to drug;myeloid dendritic cell differentiation;positive regulation of skeletal muscle tissue regeneration;response to estrogen;positive regulation of angiogenesis;response to steroid hormone;digestive tract development;positive regulation of smooth muscle cell proliferation;embryonic cranial skeleton morphogenesis;positive regulation of NK T cell differentiation;negative regulation of cardiac muscle cell proliferation;pathway-restricted SMAD protein phosphorylation;ventricular septum morphogenesis;bronchus morphogenesis;trachea formation;mammary gland morphogenesis;lung lobe morphogenesis;secondary palate development;response to cholesterol;positive regulation of epithelial to mesenchymal transition involved in endocardial cushion formation;cell proliferation involved in endocardial cushion morphogenesis;superior endocardial cushion morphogenesis;inferior endocardial cushion morphogenesis;lens fiber cell apoptotic process;miRNA transport;positive regulation of reactive oxygen species metabolic process;positive regulation of CD4-positive, alpha-beta T cell proliferation
- Cellular component
- cytosol;plasma membrane;integral component of plasma membrane;caveola;external side of plasma membrane;integral component of membrane;receptor complex;membrane raft
- Molecular function
- transmembrane receptor protein serine/threonine kinase activity;transforming growth factor beta-activated receptor activity;transforming growth factor beta receptor activity, type II;protein binding;ATP binding;glycosaminoglycan binding;growth factor binding;mitogen-activated protein kinase kinase kinase binding;type I transforming growth factor beta receptor binding;SMAD binding;metal ion binding;transforming growth factor beta binding