TMEM107

transmembrane protein 107

Basic information

Region (hg38): 17:8172457-8176399

Links

ENSG00000179029 ∙ NCBI:84314 ∙ OMIM:616183 ∙ HGNC:28128 ∙ Uniprot:Q6UX40 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Meckel syndrome (Supportive), mode of inheritance: AR
• ciliopathy (Moderate), mode of inheritance: AR
• Meckel syndrome 13 (Strong), mode of inheritance: AR
• orofaciodigital syndrome 16 (Limited), mode of inheritance: Unknown

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Joubert syndrome 29; Meckel syndrome 13; Orofaciodigital syndrome XVI	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic; Renal	26123494; 26518474; 26595381

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the TMEM107 gene.

• not provided (5 variants)
• Orofaciodigital syndrome 16 (2 variants)
• Orofaciodigital syndrome (1 variants)
• Meckel syndrome 13 (1 variants)
• Joubert syndrome 29 (1 variants)
• Leukoencephalopathy with calcifications and cysts (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the TMEM107 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				15	1	16
missense	1		29	2	1	33
nonsense			2			2
start loss						0
frameshift	3					3
inframe indel	1					1
splice donor/acceptor (+/-2bp)	1	1				2
splice region			1	2		3
non coding	1	6	110	42	28	187
Total	7	7	141	59	30

Highest pathogenic variant AF is 0.000131

Variants in TMEM107

This is a list of pathogenic ClinVar variants found in the TMEM107 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-8173297-GAACA-G			Benign (May 31, 2021)
17-8173326-T-C			Benign (May 23, 2021)
17-8173337-C-T			Benign (Mar 09, 2021)
17-8173349-T-G			Benign (May 19, 2021)
17-8173376-CCCAGTCAGAACTTCATAGCTATGTTTGTGGATATCTGCTAATCAGCATAACACAAATGTAAGTGATCGTCAGAAAGAATCAGACAGGAGCAATCAGGGTGTTGCAAGTCCTGATTACGCAGAGACGTTAATCACGTTTCATGCATCTCCAATCATCATGTTCTAATCTGCCCTCCGGAGGAGGAACAGGTAAGGATTATCCCACCTGACGATACAGACAAACAGCCGACATTCTGCACTCAGTGAAAAAGATTCCGTTACAAGCTAGGGTGAGTTCATAACG-C		Leukoencephalopathy with calcifications and cysts	Pathogenic (Apr 06, 2020)
17-8173423-A-G		TMEM107-related disorder	Benign (May 19, 2021)
17-8173426-A-C		TMEM107-related disorder	Likely benign (Feb 26, 2023)
17-8173434-G-A		TMEM107-related disorder	Likely benign (Jun 10, 2022)
17-8173437-A-G		TMEM107-related disorder	Likely benign (Dec 28, 2023)
17-8173439-T-C		TMEM107-related disorder	Likely benign (Jul 20, 2022)
17-8173439-T-G		TMEM107-related disorder	Likely benign (May 22, 2023)
17-8173440-G-A		TMEM107-related disorder	Likely benign (Feb 18, 2022)
17-8173443-C-A		Leukoencephalopathy with calcifications and cysts • not specified • TMEM107-related disorder	Benign (Aug 01, 2024)
17-8173443-C-T			Likely pathogenic (Apr 01, 2022)
17-8173444-G-A		Leukoencephalopathy with calcifications and cysts	Pathogenic/Likely pathogenic (Apr 03, 2024)
17-8173448-G-A		Leukoencephalopathy with calcifications and cysts • Meckel syndrome, type 1 • TMEM107-related disorder	Uncertain significance (Aug 07, 2018)
17-8173448-G-C		Leukoencephalopathy with calcifications and cysts	Likely pathogenic (Nov 20, 2023)
17-8173450-A-G		TMEM107-related disorder	Likely benign (Jul 25, 2024)
17-8173451-A-G		TMEM107-related disorder	Likely benign (Mar 31, 2021)
17-8173452-G-A		Leukoencephalopathy with calcifications and cysts • not specified • TMEM107-related disorder	Conflicting classifications of pathogenicity (Apr 01, 2024)
17-8173455-T-C			Uncertain significance (Aug 01, 2023)
17-8173455-T-G			Uncertain significance (Apr 28, 2022)
17-8173456-C-CA			Uncertain significance (Nov 01, 2023)
17-8173458-G-C		Leukoencephalopathy with calcifications and cysts	Conflicting classifications of pathogenicity (Jan 02, 2024)
17-8173458-G-T		Leukoencephalopathy with calcifications and cysts	Pathogenic (Apr 06, 2020)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
TMEM107	protein_coding	protein_coding	ENST00000316425	5	3163

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
3.05e-8	0.0507	125729	0	19	125748	0.0000756

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.09	58	86.5	0.670	0.00000443	941
Missense in Polyphen		21	34.33	0.61172		389
Synonymous	0.681	32	37.3	0.858	0.00000211	307
Loss of Function	-0.906	10	7.35	1.36	3.12e-7	82

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000119	0.000119
Ashkenazi Jewish	0.000198	0.000198
East Asian	0.0000544	0.0000544
Finnish	0.00	0.00
European (Non-Finnish)	0.0000703	0.0000703
Middle Eastern	0.0000544	0.0000544
South Asian	0.000131	0.000131
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Plays a role in cilia formation and embryonic patterning. Requires for normal Sonic hedgehog (Shh) signaling in the neural tube and acts in combination with GLI2 and GLI3 to pattern ventral and intermediate neuronal cell types (By similarity). During ciliogenesis regulates the ciliary transition zone localization of some MKS complex proteins (PubMed:26518474). {ECO:0000250|UniProtKB:Q9CPV0, ECO:0000269|PubMed:26518474}.
• Disease: DISEASE: Meckel syndrome 13 (MKS13) [MIM:617562]: A form of Meckel syndrome, a disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. {ECO:0000269|PubMed:26123494, ECO:0000269|PubMed:26595381}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Orofaciodigital syndrome 16 (OFD16) [MIM:617563]: A form of orofaciodigital syndrome, a group of heterogeneous disorders characterized by malformations of the oral cavity, face and digits, and associated phenotypic abnormalities that lead to the delineation of various subtypes. OFD16 features include postaxial polydactyly of the hands and feet, multiple tongue cysts, and dysmorphic features, including frontal narrowing, short palpebral fissures, flat nasal bridge, retrognathia, and low-set ears. Neurologic features include delayed psychomotor development and severe cognitive impairment. OFD16 inheritance is autosomal recessive. {ECO:0000269|PubMed:26518474, ECO:0000269|PubMed:26595381}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Intolerance Scores

• loftool: 0.515
• rvis_EVS: -0.01
• rvis_percentile_EVS: 52.85

Haploinsufficiency Scores

• pHI: 0.132
• hipred: N
• hipred_score: 0.244
• ghis: 0.557

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.218

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Low	Medium
Primary Immunodeficiency	Medium	Low	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Tmem107
• Phenotype: embryo phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); vision/eye phenotype; digestive/alimentary phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); skeleton phenotype; cellular phenotype; growth/size/body region phenotype; craniofacial phenotype

Gene ontology

• Biological process: neural tube patterning;embryonic digit morphogenesis;cilium assembly;protein localization to ciliary transition zone;non-motile cilium assembly
• Cellular component: integral component of membrane;ciliary transition zone;MKS complex
• Molecular function: molecular_function;protein binding