TMEM230

transmembrane protein 230

Basic information

Region (hg38): 20:5068231-5113103

Previous symbols: [ "C20orf30" ]

Links

ENSG00000089063 ∙ NCBI:29058 ∙ OMIM:617019 ∙ HGNC:15876 ∙ Uniprot:Q96A57 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Parkinson disease (Moderate), mode of inheritance: Semidominant

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the TMEM230 gene.

• not provided (43 variants)
• Inborn genetic diseases (4 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the TMEM230 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1	7	3	11
missense	1		14	1	2	18
nonsense						0
start loss			2	1		3
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)			1			1
splice region				1		1
non coding			1	2	9	12
Total	1	0	19	11	14

Highest pathogenic variant AF is 0.0000131

Variants in TMEM230

This is a list of pathogenic ClinVar variants found in the TMEM230 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
20-5069280-T-G		TMEM230-related disorder	Likely benign (Jan 11, 2021)
20-5069330-C-T		TMEM230-related disorder	Likely benign (Nov 03, 2020)
20-5100831-C-T		not specified	Uncertain significance (Sep 25, 2023)
20-5100832-G-A			Benign (Nov 22, 2023)
20-5100843-G-A			Uncertain significance (Jun 10, 2021)
20-5100857-G-A			Likely benign (Jun 26, 2022)
20-5100861-C-A		not specified	Uncertain significance (Sep 14, 2022)
20-5100862-G-C		not specified	Uncertain significance (Dec 21, 2022)
20-5100892-G-C			Uncertain significance (Sep 27, 2022)
20-5100921-C-A			Pathogenic (Sep 04, 2023)
20-5100922-G-T			Likely benign (Jun 27, 2023)
20-5100928-C-G		not specified	Uncertain significance (Mar 08, 2024)
20-5100946-A-C			Likely benign (Aug 13, 2022)
20-5101102-C-G			Benign (May 16, 2021)
20-5101105-CA-C			Benign (May 23, 2021)
20-5106074-GACAA-G			Benign (May 17, 2021)
20-5106074-GACAAAC-G			Benign (May 16, 2021)
20-5106074-GACAAACAC-G			Benign (May 19, 2021)
20-5106074-GACAAACACAC-G			Benign (May 21, 2021)
20-5106076-CAA-C			Benign (May 16, 2021)
20-5106078-A-AAC			Benign (May 17, 2021)
20-5106078-A-AACAC			Benign (May 23, 2021)
20-5106178-G-A			Likely benign (Jan 26, 2024)
20-5106196-TGATGTAGCCTGACAGCAGGAGGGAGCCTATAATAATGAGAAAGGCGCCAATCAAAAACAGCACAGTGGCAAGTGCGATGGCCTTATAAGGGATCTTAGGAGGGGTTTTCTTAAACTGGAAGAGAAATAGAGATGAAAAAGACAACGAAGAACATTAATGCAAATACCTGGGTTCAAACATTTAATTAATTATTTGTAATTTTTATGTTTTTGTTTGTTTGTTTTGAGATGGAGTTTCGTTCTTGTTGCCCAGGCTAGAGAGCAATGGCGTGATCTTGGCTCACTGCAACCTCTGCCTCCTGGATTCAAGTGATTCTCCTGTCTCAGCCTCCTGAGCAGCTGGGGTTACAGGTGCCCGCCACTACACCCAGCTAATTTTTTTGGTATTTTTAGTAGAGACAGGGTTTCACCTTGTTGACCTGGCTGGGCTTGAACTCCTGACCTCAGGTGATCCGCCCGCCTCGGCCTCCCAAAGTGCTGGCATTACAGGCGTGAGCCACCGCGCCCGGCCTAATTTTTATGATTTTAGAGACGGAGTCTTGCTCTATCACCCAGGCTGGAGTGCAGTGGTGCAATTACAGCTCATTGCAGCCTCGAACTCCTGGGCTCAAGCAATTCTCTTGCCTCATCCTCTCAAGTAGCTGGGACTACAAGTATACGTCACCATGCCCAGCTAATTTTTAAATTTTTCTGTAGAGACGAGGTCTCACTATGTTGCCCAGGGTGGTCTCCAACTCCTGGGCTCAAGGGAGTCCTTCCACCTCTGCCTCCCAAAGTGCTGGGATTACAGGTATAAGCCATCAAGCCCAGTCTCAAACACTTTAAAACAGGGAGGAGAGCTCGCACCTGTAATCCCAGCAATGTGGGAGGCTGAGGCAGGCGGATCACTTGAGTTCAGGAGTTTGAGACCAGCCTGAGCAACATGGTGAAACCTCGTCTCTACAAAAAATACAAAAATTAGCC-T			Uncertain significance (Jan 21, 2022)
20-5106202-A-G		not specified	Uncertain significance (Jan 23, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
TMEM230	protein_coding	protein_coding	ENST00000342308	5	13264

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000181	0.480	125727	0	20	125747	0.0000795

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.360	84	93.8	0.895	0.00000490	1139
Missense in Polyphen		10	21.532	0.46442		278
Synonymous	0.444	35	38.5	0.909	0.00000204	390
Loss of Function	0.325	6	6.92	0.867	2.97e-7	98

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000618	0.0000615
Ashkenazi Jewish	0.00	0.00
East Asian	0.000272	0.000272
Finnish	0.00	0.00
European (Non-Finnish)	0.0000441	0.0000439
Middle Eastern	0.000272	0.000272
South Asian	0.000261	0.000261
Other	0.000164	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Involved in trafficking and recycling of synaptic vesicles. {ECO:0000269|PubMed:27270108}.
• Disease: DISEASE: Parkinson disease (PARK) [MIM:168600]: A complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability. Additional features are characteristic postural abnormalities, dysautonomia, dystonic cramps, and dementia. The pathology of Parkinson disease involves the loss of dopaminergic neurons in the substantia nigra and the presence of Lewy bodies (intraneuronal accumulations of aggregated proteins), in surviving neurons in various areas of the brain. The disease is progressive and usually manifests after the age of 50 years, although early-onset cases (before 50 years) are known. The majority of the cases are sporadic suggesting a multifactorial etiology based on environmental and genetic factors. However, some patients present with a positive family history for the disease. Familial forms of the disease usually begin at earlier ages and are associated with atypical clinical features. {ECO:0000269|PubMed:27270108}. Note=The gene represented in this entry may be involved in disease pathogenesis. Genetic variants in TMEM230 and DNAJC13 have been found in the same large multigenerational family with adult-onset Parkinson disease. The pathological role of each gene and therefore the exact molecular basis of the disease is unclear. {ECO:0000305|PubMed:27270108}.

Recessive Scores

• pRec: 0.0918

Haploinsufficiency Scores

• pHI: 0.158
• hipred: N
• hipred_score: 0.306
• ghis: 0.613

Essentials

• essential_gene_CRISPR: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.114

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Tmem230

Gene ontology

• Biological process: synaptic vesicle transport
• Cellular component: early endosome;late endosome;autophagosome;endoplasmic reticulum;trans-Golgi network;synaptic vesicle;integral component of membrane;cell junction;recycling endosome