UCMA

upper zone of growth plate and cartilage matrix associated

Basic information

Region (hg38): 10:13221765-13234374

Previous symbols: [ "C10orf49" ]

Links

ENSG00000165623 ∙ NCBI:221044 ∙ ∙ HGNC:25205 ∙ Uniprot:Q8WVF2 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the UCMA gene.

• Inborn genetic diseases (5 variants)
• Autism (1 variants)
• not provided (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the UCMA gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			5		1	6
nonsense						0
start loss						0
frameshift						0
inframe indel			1			1
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	0	0	6	0	1

Variants in UCMA

This is a list of pathogenic ClinVar variants found in the UCMA region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
10-13222107-G-C		Keratoconus	Uncertain significance (Apr 01, 2023)
10-13222116-C-T		not specified	Uncertain significance (Oct 17, 2023)
10-13222135-G-C		not specified	Uncertain significance (Jan 29, 2024)
10-13222161-C-T		not specified	Uncertain significance (Nov 23, 2021)
10-13222182-C-T		not specified	Uncertain significance (Dec 06, 2022)
10-13222183-G-A		not specified	Uncertain significance (Oct 30, 2023)
10-13222200-T-C		not specified	Uncertain significance (Dec 22, 2023)
10-13229614-C-T		not specified	Uncertain significance (Feb 06, 2024)
10-13229626-C-G		not specified	Uncertain significance (Feb 28, 2024)
10-13233314-TGGGGCCTCCTAACCCTGACAAAGTATTCAATCCAATATACGACCTACAGTCAGGAAATAGGGTGTAATTTCTCATTCAGAGCTGCAGTCCCTTTGATACCCTGGGGTGAGCCCTTCGTGCCCAGCTGCATCCTGCTGCCCGGCTGACTGTGGGAGAGGAGGAGCCGGGGGGTGTGAGCAGAGGTGGTGATGGACGCGGGATGGGGTCCCTCCAGCATCCTTACCATTGACCTCATCTCTGGACTTGGGGGACCGCTTGCCGCGCCTCTTGAGGAAATTCGAGGCATCTGATTCCTGCATGAAAATCTTCTGTTTTGCATCTGAAACCCGGGAGAGGCCTGTCACCAGCAGTGTGGGGGTGCTGGGGCTGCTGCTTCGCTGGCTGCACCTGCCCTGCCCCGTGGGTGGCCCCTGCACTCACCTTCACTCGCCTCTTCTCCCGCCATCTGCATGGTGCCCACAGATACACTGGTTCCCTCTCTCAGCACTGCAGGACAAGGGCACAGAGTGAGGCTGCAGCATCAGAGGGGAGCCCAGACCCTGAGCTGAGTCCCCATCTCTCTTTCCAGGCTAAGCGTCCTGCCAGGGCCTGGCAGGGGGCCCGTGGTTTCTCACGTACCAGCTGCAGAGCCAATCTCCCCAGGAACCCACCAAGCAAGCTGGCTTGGGTTTTTTTTCTATTTTGTTTCTTTCTTTACTGTTTTTTATTATTATTATTATTTTTCTGTATTGCATTGTGTCCTACATGCACACGACACACACATACACACATGTTAACAATAAGCATACTCCTTTCTACCTGCATCACCTGAGCAGCCTTACCTGTGCATGGTAAGTCTCCCTTACCATGTAACTAACACCCTCCACCTTGACCCTCCTGTACTCACTAGACAGGAGCACCACGGCGGAGAAGCAAGACAGCAGGACGG-T		Autism	Uncertain significance (Apr 30, 2021)
10-13233568-G-A		not specified	Uncertain significance (Dec 30, 2023)
10-13233571-T-G		not specified	Uncertain significance (May 24, 2023)
10-13233613-T-C		not specified	Uncertain significance (Apr 18, 2023)
10-13233624-T-C		not specified	Uncertain significance (Aug 09, 2021)
10-13233632-A-C		not specified	Uncertain significance (Sep 15, 2021)
10-13233742-C-T		not specified	Likely benign (Jan 03, 2024)
10-13233764-A-G			Benign (May 04, 2018)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
UCMA	protein_coding	protein_coding	ENST00000378681	5	12568

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00000906	0.338	125691	0	56	125747	0.000223

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.199	93	87.8	1.06	0.00000569	909
Missense in Polyphen		40	29.111	1.3741		284
Synonymous	-0.367	38	35.2	1.08	0.00000239	242
Loss of Function	0.215	8	8.68	0.921	3.69e-7	100

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000329	0.000329
Ashkenazi Jewish	0.00	0.00
East Asian	0.000598	0.000598
Finnish	0.00	0.00
European (Non-Finnish)	0.000281	0.000281
Middle Eastern	0.000598	0.000598
South Asian	0.000163	0.000131
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: May be involved in the negative control of osteogenic differentiation of osteochondrogenic precursor cells in peripheral zones of fetal cartilage and at the cartilage-bone interface. {ECO:0000250}.
• Pathway: RUNX2 regulates osteoblast differentiation;RUNX2 regulates bone development;Transcriptional regulation by RUNX2;Gene expression (Transcription);Generic Transcription Pathway;RNA Polymerase II Transcription (Consensus)

Recessive Scores

• pRec: 0.0506

Intolerance Scores

• rvis_EVS: 1.28
• rvis_percentile_EVS: 93.68

Haploinsufficiency Scores

• pHI: 0.0128
• hipred: N
• hipred_score: 0.167

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.00403

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Ucma

Zebrafish Information Network

• Gene name: ucmab
• Affected structure: head
• Phenotype tag: abnormal
• Phenotype quality: malformed

Gene ontology

• Biological process: negative regulation of osteoblast differentiation
• Cellular component: extracellular matrix