UNC80

unc-80 homolog, NALCN channel complex subunit

Basic information

Region (hg38): 2:209771831-209999300

Previous symbols: [ "C2orf21" ]

Links

ENSG00000144406 ∙ NCBI:285175 ∙ OMIM:612636 ∙ HGNC:26582 ∙ Uniprot:Q8N2C7 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• hypotonia, infantile, with psychomotor retardation and characteristic facies 2 (Definitive), mode of inheritance: AD
• hypotonia, infantile, with psychomotor retardation and characteristic facies (Supportive), mode of inheritance: AR
• hypotonia, infantile, with psychomotor retardation and characteristic facies 2 (Strong), mode of inheritance: AR
• hypotonia, infantile, with psychomotor retardation and characteristic facies 2 (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Hypotonia, infantile, with psychomotor retardation and characteristic facies 2	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic	26862157; 26708751; 26708753

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the UNC80 gene.

• not provided (1750 variants)
• Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 (129 variants)
• Inborn genetic diseases (96 variants)
• not specified (8 variants)
• See cases (3 variants)
• UNC80-related condition (3 variants)
• Encephalopathy (3 variants)
• Neurodevelopmental delay (2 variants)
• UNC80-Related Disorder (2 variants)
• Global developmental delay (1 variants)
• Moderate global developmental delay (1 variants)
• Intellectual disability (1 variants)
• Hypotonia, infantile, with psychomotor retardation and characteristic facies (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the UNC80 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			9	435	32	476
missense		4	817	18	11	850
nonsense	30	9	1			40
start loss			1			1
frameshift	17	9	4			30
inframe indel			16			16
splice donor/acceptor (+/-2bp)	4	19				23
splice region		1	44	59	8	112
non coding			9	242	21	272
Total	51	41	857	695	64

Highest pathogenic variant AF is 0.0000197

Variants in UNC80

This is a list of pathogenic ClinVar variants found in the UNC80 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-209772013-G-GCGGCGGCTAGCGAGGAGACAGAGCTGGGTCCTGCAGTAGGACTCCCGGGAGCCACCATTATGGTGAAGAGGAAGAGCTCCGAGGGCCAGGAGCAGGA			Uncertain significance (Aug 09, 2022)
2-209772075-G-A			Uncertain significance (Aug 17, 2022)
2-209772098-G-C			Uncertain significance (Jul 05, 2022)
2-209772109-G-A			Uncertain significance (Jun 05, 2022)
2-209772116-G-A			Uncertain significance (Mar 22, 2022)
2-209772122-G-T			Uncertain significance (Feb 22, 2021)
2-209772123-C-G			Likely benign (Jun 08, 2023)
2-209772126-C-T			Likely benign (Jul 06, 2022)
2-209772130-C-T			Benign (Feb 01, 2024)
2-209772141-G-T			Uncertain significance (Mar 06, 2022)
2-209772142-A-G			Uncertain significance (Oct 13, 2022)
2-209772143-C-A		Inborn genetic diseases	Uncertain significance (Aug 08, 2022)
2-209772154-C-A			Likely benign (Dec 27, 2022)
2-209772162-C-T			Likely benign (Nov 18, 2023)
2-209772169-G-T			Uncertain significance (May 06, 2022)
2-209772171-G-A		Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 • UNC80-related disorder	Benign/Likely benign (Feb 01, 2024)
2-209772172-G-T			Likely benign (Sep 27, 2023)
2-209772174-G-A			Likely benign (May 11, 2023)
2-209773076-T-C			Likely benign (Mar 29, 2021)
2-209773086-T-C			Likely benign (Jun 22, 2022)
2-209773101-T-C			Likely benign (Aug 10, 2023)
2-209773106-G-A			Likely benign (Dec 10, 2022)
2-209773107-C-A		Inborn genetic diseases	Uncertain significance (Jan 20, 2023)
2-209773107-C-G			Uncertain significance (Dec 02, 2020)
2-209773132-C-T			Uncertain significance (Apr 19, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
UNC80	protein_coding	protein_coding	ENST00000439458	64	227308

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0523	0.948	125726	0	19	125745	0.0000756

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	5.53	1089	1.74e+3	0.627	0.0000996	21316
Missense in Polyphen		591	1021.7	0.57846		12466
Synonymous	3.79	539	663	0.813	0.0000382	6422
Loss of Function	9.12	39	166	0.235	0.0000100	1901

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000123	0.000123
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.000132	0.000132
Middle Eastern	0.00	0.00
South Asian	0.0000327	0.0000327
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Component of the NALCN sodium channel complex, required for channel regulation. This complex is a cation channel activated by neuropeptides substance P, neurotensin, and extracellular calcium that regulates neuronal excitability by controlling the sizes of NALCN-dependent sodium-leak current. UNC80 is essential for NALCN sensitivity to extracellular calcium. {ECO:0000250|UniProtKB:Q8BLN6}.
• Disease: DISEASE: Hypotonia, infantile, with psychomotor retardation and characteristic facies 2 (IHPRF2) [MIM:616801]: An autosomal recessive, neurodegenerative disease characterized by severe truncal hypotonia since birth or early infancy, progressive peripheral spasticity, and profound psychomotor developmental delay. Some patients may have seizures. {ECO:0000269|PubMed:26545877, ECO:0000269|PubMed:26708751, ECO:0000269|PubMed:26708753}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Stimuli-sensing channels;Ion channel transport;Transport of small molecules (Consensus)

Intolerance Scores

• loftool: 0.640
• rvis_EVS: 0.99
• rvis_percentile_EVS: 90.5

Haploinsufficiency Scores

• pHI: 0.613
• hipred: Y
• hipred_score: 0.527
• ghis: 0.467

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.231

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Unc80

Gene ontology

• Biological process: ion transmembrane transport
• Cellular component: plasma membrane;integral component of membrane