ZAR1L

zygote arrest 1 like, the group of Zinc fingers 3CxxC-type

Basic information

Region (hg38): 13:32303699-32315363

Links

ENSG00000189167 ∙ NCBI:646799 ∙ ∙ HGNC:37116 ∙ Uniprot:A6NP61 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ZAR1L gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ZAR1L gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			11	3		14
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			1		4	5
Total	0	0	12	3	4

Variants in ZAR1L

This is a list of pathogenic ClinVar variants found in the ZAR1L region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
13-32303938-G-A		not specified	Uncertain significance (Mar 04, 2024)
13-32311284-C-A		not specified	Uncertain significance (Apr 07, 2023)
13-32311285-C-T		not specified	Likely benign (Aug 28, 2023)
13-32311289-G-A		not specified	Uncertain significance (Jun 07, 2024)
13-32311291-A-C		not specified	Uncertain significance (Nov 10, 2022)
13-32311307-C-T		not specified	Uncertain significance (Aug 15, 2023)
13-32311358-T-C		not specified	Likely benign (Jun 26, 2023)
13-32311475-C-T		not specified	Uncertain significance (Nov 17, 2022)
13-32311562-C-A		not specified	Uncertain significance (Jan 26, 2022)
13-32311678-A-G		not specified	Uncertain significance (Nov 02, 2021)
13-32311684-G-A		not specified	Likely benign (Apr 05, 2023)
13-32311730-C-G		not specified	Uncertain significance (Jul 13, 2022)
13-32311792-G-C		not specified	Uncertain significance (Mar 22, 2023)
13-32311802-T-G		not specified	Uncertain significance (May 04, 2023)
13-32311831-G-T		not specified	Uncertain significance (Jun 01, 2022)
13-32314943-A-G		Breast-ovarian cancer, familial, susceptibility to, 2	Benign (Jan 12, 2015)
13-32315212-G-A		Hereditary breast ovarian cancer syndrome	Benign (Sep 01, 2022)
13-32315226-G-A		Breast-ovarian cancer, familial, susceptibility to, 2	Benign (Jan 12, 2015)
13-32315300-G-A		Hereditary breast ovarian cancer syndrome	Benign (Dec 22, 2022)
13-32315355-A-G		Hereditary breast ovarian cancer syndrome	Uncertain significance (Jul 15, 2020)
13-32315355-ATGCCTGACAAGGAATTTCCTTTCGCCACACTGAGAAATACCCGCAGCGGCCCACCCAGGCCTGACTTCCGGGTGGTGCGTGTGCTGCGTGTCGCGTCACGGCGTCACGTGGCCAGCGCGGGCTTGTGGCGCGAGCTTCTGAAACTAGGCGGCAGAGGCGGAGCCGCTGTGGCACTGCTGCGCCTCTGCTGCGCCTCGGGTGTCTTTTGCGGCGGTGGGTCGCCGCCGGGAGAAGCGTGAGGGGACAGATTTGTGACCGGCGCGGTTTTTGTCAGCTTACTCCGGCCAAAAAAGAACTGCACCTCTGGAGCGGGTTAGTGGTGGTGGTAGTGGGTTGGGACGAGCGCGTCTTCCGCAGTCCCAGTCCAGCGTGGCGGGGGAGCGCCTCACGCCCCGGGTCGCTGCCGCGGCTTCTTGCCCTTTTGTCTCTGCCAACCCCCACCCATGCCTGAGAGAAAGGTCCTTGCCCGAAGGCAGATTTTCGCCAAGCAAATTCGAGCCCCGCCCCTTCCCTGGGTCTCCATTTCCCGCCTCCGGCCCGGCCTTTGGGCTCCGCCTTCAGCTCAAGACTTAACTTCCCTCCCAGCTGTCCCAGATGACGCCATCTGAAATTTCTTGGAAACACGATCACTTTAACGGAATATTGCTGTTTTGGGGAAGTGTTTTACAGCTGCTGGGCACGCTGTATTTGCCTTACTTAAGCCCCTGGTAATTGCTGTATTCCGAAGACATGCTGATGGGAATTACCAGGCGGCGTTGGTCTCTAACTGGAGCCCTCTGTCCCCACTAGCCACGCGTCACTGGTTAGCGTGATTGAAACTAAATCGTATGAAAATCCTCTTCTCTAGTCGCACTAGCCACGTTTCGAGTGCTTAATGTGGCTAGTGGCACCGGTTTGGACAGCACAGCTGTAAAATGTTCCCATCCTCACAGTAAGC-A		Hereditary breast ovarian cancer syndrome;Breast-ovarian cancer, familial, susceptibility to, 2	Pathogenic (Sep 01, 2019)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ZAR1L	protein_coding	protein_coding	ENST00000533490	4	11645

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0993	0.894	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.69	123	188	0.654	0.0000116	2067
Missense in Polyphen		19	39.379	0.48249		558
Synonymous	1.51	64	81.3	0.787	0.00000567	628
Loss of Function	2.37	4	13.3	0.300	6.90e-7	159

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

Intolerance Scores

• rvis_EVS: 0.3
• rvis_percentile_EVS: 71.81

Essentials

• essential_gene_CRISPR: E
• essential_gene_CRISPR2: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.0801

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Zar1l

Gene ontology

• Cellular component: cytoplasm