ZSWIM8-AS1

ZSWIM8 antisense RNA 1, the group of Antisense RNAs

Basic information

Region (hg38): 10:73796514-73801399

Links

ENSG00000272589 ∙ NCBI:100507331 ∙ ∙ HGNC:45103 ∙ ∙ ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ZSWIM8-AS1 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ZSWIM8-AS1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense						0
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			38	3		41
Total	0	0	38	3	0

Variants in ZSWIM8-AS1

This is a list of pathogenic ClinVar variants found in the ZSWIM8-AS1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
10-73796798-G-A		not specified	Uncertain significance (Dec 19, 2022)
10-73796849-C-T		not specified	Uncertain significance (Jan 11, 2023)
10-73797154-G-T		not specified	Uncertain significance (Jun 27, 2023)
10-73797209-G-A		not specified	Uncertain significance (May 27, 2022)
10-73797220-T-C		not specified	Uncertain significance (May 01, 2024)
10-73797250-C-T		not specified	Uncertain significance (Mar 23, 2023)
10-73797463-G-A		not specified	Uncertain significance (Dec 14, 2021)
10-73797478-G-A		not specified	Uncertain significance (Feb 06, 2024)
10-73797580-C-T		not specified	Uncertain significance (Nov 10, 2022)
10-73798252-C-T			Likely benign (Mar 01, 2022)
10-73798341-G-A		not specified	Uncertain significance (May 30, 2023)
10-73798446-A-G		not specified	Uncertain significance (Oct 26, 2022)
10-73799017-G-A		not specified	Uncertain significance (Dec 26, 2023)
10-73799029-A-G		not specified	Uncertain significance (Dec 21, 2022)
10-73799031-G-A		not specified	Uncertain significance (Sep 12, 2024)
10-73799200-C-T		not specified	Uncertain significance (Jan 09, 2024)
10-73799201-G-A		not specified	Uncertain significance (Apr 05, 2023)
10-73799207-T-C		not specified	Uncertain significance (Sep 20, 2023)
10-73799216-G-A		not specified	Uncertain significance (Feb 27, 2024)
10-73799245-A-G		not specified	Uncertain significance (Jun 06, 2023)
10-73799290-G-A		not specified	Uncertain significance (Dec 30, 2023)
10-73799386-C-T		not specified	Uncertain significance (Aug 08, 2023)
10-73799441-ACATGCCCCGGCCTGCCGTCTTCCCTGTGCCCAGCTCTGCATACCCACAGGTGAGACCAGTGTTCTGCTGGGGGGTAAGGCATGGGAAAATACTGGGAATT-A			Uncertain significance (Sep 27, 2023)
10-73799445-G-A		not specified	Uncertain significance (Sep 20, 2023)
10-73800038-C-G		not specified	Uncertain significance (Oct 07, 2024)

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP