ZSWIM8-AS1
Basic information
Region (hg38): 10:73796514-73801399
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the ZSWIM8-AS1 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 0 | |||||
missense | 0 | |||||
nonsense | 0 | |||||
start loss | 0 | |||||
frameshift | 0 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region | 0 | |||||
non coding | 38 | 41 | ||||
Total | 0 | 0 | 38 | 3 | 0 |
Variants in ZSWIM8-AS1
This is a list of pathogenic ClinVar variants found in the ZSWIM8-AS1 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
10-73796798-G-A | not specified | Uncertain significance (Dec 19, 2022) | ||
10-73796849-C-T | not specified | Uncertain significance (Jan 11, 2023) | ||
10-73797154-G-T | not specified | Uncertain significance (Jun 27, 2023) | ||
10-73797209-G-A | not specified | Uncertain significance (May 27, 2022) | ||
10-73797220-T-C | not specified | Uncertain significance (May 01, 2024) | ||
10-73797250-C-T | not specified | Uncertain significance (Mar 23, 2023) | ||
10-73797463-G-A | not specified | Uncertain significance (Dec 14, 2021) | ||
10-73797478-G-A | not specified | Uncertain significance (Feb 06, 2024) | ||
10-73797580-C-T | not specified | Uncertain significance (Nov 10, 2022) | ||
10-73798252-C-T | Likely benign (Mar 01, 2022) | |||
10-73798341-G-A | not specified | Uncertain significance (May 30, 2023) | ||
10-73798446-A-G | not specified | Uncertain significance (Oct 26, 2022) | ||
10-73799017-G-A | not specified | Uncertain significance (Dec 26, 2023) | ||
10-73799029-A-G | not specified | Uncertain significance (Dec 21, 2022) | ||
10-73799031-G-A | not specified | Uncertain significance (Sep 12, 2024) | ||
10-73799200-C-T | not specified | Uncertain significance (Jan 09, 2024) | ||
10-73799201-G-A | not specified | Uncertain significance (Apr 05, 2023) | ||
10-73799207-T-C | not specified | Uncertain significance (Sep 20, 2023) | ||
10-73799216-G-A | not specified | Uncertain significance (Feb 27, 2024) | ||
10-73799245-A-G | not specified | Uncertain significance (Jun 06, 2023) | ||
10-73799290-G-A | not specified | Uncertain significance (Dec 30, 2023) | ||
10-73799386-C-T | not specified | Uncertain significance (Aug 08, 2023) | ||
10-73799441-ACATGCCCCGGCCTGCCGTCTTCCCTGTGCCCAGCTCTGCATACCCACAGGTGAGACCAGTGTTCTGCTGGGGGGTAAGGCATGGGAAAATACTGGGAATT-A | Uncertain significance (Sep 27, 2023) | |||
10-73799445-G-A | not specified | Uncertain significance (Sep 20, 2023) | ||
10-73800038-C-G | not specified | Uncertain significance (Oct 07, 2024) |
GnomAD
Source:
dbNSFP
Source: