Analysis of 5' (Donor) and 3' (Acceptor) splice site mutations using MaxEntScan.
This tool is highly experimental. Results should be interpreted with caution and validated with additional methods.
Minimal length: 23 nucleotides; example: CTGCCATTGTCAGAGGTAAGTAGCCGTAGCTAGCTAG
Calculated using a 9bp sliding window (3bp exon / 6bp intron). Hover over the scores to view higher-precision values.
Calculated using a 23bp sliding window (20bp intron / 3bp exon). Hover over the scores to view higher-precision values.